Fam162a (NM_027342) Mouse Untagged Clone
CAT#: MC201170
Fam162a (untagged) - Mouse family with sequence similarity 162, member A (Fam162a), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310056P07Rik; HGTD-P |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010826 sequence for NM_027342
GCGTCGGCGGAGCGGGTGGCCATGTGGAGCCTCGGCGGCCTGCGCCTGGCGGCTGGACATTGTCTTAGGT TATATGAAAGAAATGCTTCCTCGTCTCTAAGGTTTACCAGAAACACTGACTTGAAGAGGATCAATGGATT CTGCACCAAGCCACAGGAAAGTCCCAAAACTCCAACCCAGTCTTACAGACACGGGGTGCCGCTGCACAAG CCCACAGATTTTGAGAAGAAGATCCTGCTGTGGTCAGGCCGCTTCAAGAAGGAGGAAGAGATCCCAGAGA CAATCTCATTTGAGATGCTTGATGCTGCGAAGAACAAGCTCCGGGTGAAGGTCAGCTATCTAATGATTGC CCTGACCGTGGCAGGATGCATCTATATGGTTATTGAGGGCAAGAAGGCTGCGAAAAGACATGAGTCTTTA ACAAGCTTGAACCTGGAAAGGAAAGCCCGTCTGAGAGAGGAGGCAGCTATGAAGGCCAAAACAGACTAGA AGTATTTGGAAAACCCAGGAGTAAGGCTGCAACAAGAAACCTGCTTTACAAAGGATACAATCTGAGACTC ACTTTGCAGACATGTATTTTGCACAGATGTATTCCACTTCCCTATTAATGCTGTAGAGGAACAAATACAT TTTCTTAAAGAATGAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_027342 |
Insert Size | 468 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC010826, AAH10826 |
RefSeq Size | 670 bp |
RefSeq ORF | 468 bp |
Locus ID | 70186 |
UniProt ID | Q9D6U8 |
Gene Summary | Proposed to be involved in regulation of apoptosis; the exact mechanism may differ between cell types/tissues. May be involved in hypoxia-induced cell death of transformed cells implicating cytochrome C release and caspase activation (such as CASP9) and inducing mitochondrial permeability transition. May be involved in hypoxia-induced cell death of neuronal cells probably by promoting release of AIFM1 from mitochondria to cytoplasm and its translocation to the nucleus; however, the involvement of caspases has been reported conflictingly.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201149 | Fam162a (tGFP-tagged) - Mouse RIKEN cDNA 2310056P07 gene (2310056P07Rik) |
CNY 2,850.00 |
|
MR201149 | Fam162a (Myc-DDK-tagged) - Mouse family with sequence similarity 162, member A (Fam162a) |
CNY 1,200.00 |
|
MR201149L3 | Lenti ORF clone of Fam162a (Myc-DDK-tagged) - Mouse family with sequence similarity 162, member A (Fam162a) |
CNY 4,750.00 |
|
MR201149L4 | Lenti ORF clone of Fam162a (mGFP-tagged) - Mouse family with sequence similarity 162, member A (Fam162a) |
CNY 4,750.00 |
其它Fam162a产品