Atp5j (NM_016755) Mouse Untagged Clone
CAT#: MC201094
Atp5j (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F (Atp5j), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Atp5pf; CF6 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010766 sequence for NM_016755
CGCTCCCCGCCAGCCCGCGTCCGCAACTCACCAGCTCCGGAATTCGTCCCGTGGCCCTAGCCCGCGCTTC CACAGCCGGCTGGGAACGGCGGCGGCGCGGGCTCCAGGTACAGCGCCTCTCCGGGCGAGCCGCGCCGCTC CCGCGAGTAGCAGGAGGCGTCCGGTCGCAGACTCCCTTCGAGGCGCTTCCTGTCCGGTGAGCGTCGAACG ACTGAAGCCGCGGCCCATAGTGCCTTGCGATGGCGGGTAGGCGTGTGTAGGCGGAGCCAGGGCCGGAAGT AGAACGGTGGCGGCGGCGGTGACTCTGGCAGCTCGGGACTCAGTGCAAGTACAGAGACTCAGCCATGGTT CTGCAGAGGATCTTCAGGCTCTCCTCTGTCCTTCGGTCAGCAGTCTCTGTGCATTTGAAGAGGAACATTG GTGTTACAGCTGTGGCCTTTAATAAGGAACTTGATCCTGTACAGAAACTCTTCGTGGACAAGATAAGAGA GTACAAATCAAAGCGACAGGCATCTGGAGGACCTGTTGATATTGGCCCAGAGTATCAGCAAGATCTGGAC AGAGAGCTTTATAAGCTTAAACAAATGTATGGTAAAGGAGAGATGGATACATTTCCTACCTTCAAATTTG ATGATCCCAAATTTGAAGTCATCGACAAACCCCAGTCCTGAGGAACATACAAAATCCATGTGGTAATTTG TCATGAATTAGTTGTACAACTAATCAAAAAATTCAAATAAACATTCATTTCACAGTTAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_016755 |
Insert Size | 327 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC010766, AAH10766 |
RefSeq Size | 797 bp |
RefSeq ORF | 327 bp |
Locus ID | 11957 |
UniProt ID | P97450 |
Gene Summary | The protein encoded by this gene is a component of mitochondrial adenosine triphosphate synthase, which catalyzes the conversion of ATP from ADP. Mitochondrial adenosine triphosphate synthase consists of extrinsic and intrinsic membrane domains that are joined by a stalk. The protein encoded by this gene is a subunit of the stalk domain. A bi-directional promoter that drives expression of this gene has been has been identified. Pseudogenes of this gene are found on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, 5, 6 and 7 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200403 | Atp5j (Myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F (Atp5j), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
MR200403L3 | Lenti ORF clone of Atp5j (Myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F (Atp5j), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
MR200403L4 | Lenti ORF clone of Atp5j (mGFP-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F (Atp5j), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |