Fis1 (NM_025562) Mouse Untagged Clone

CAT#: MC201086

Fis1 (untagged) - Mouse fission 1 (mitochondrial outer membrane) homolog (yeast) (Fis1), nuclear gene encoding mitochondrial protein, transcript variant 1, (10ug)



  "NM_025562" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2010003O14Rik; Ttc11
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC010783 sequence for NM_025562
GCCTCTCCGCCCCTGCTACTGGACCATGGAGACTGTGGCCCAGTAGAGACCTTAGTGTGAGGCTTTCAGG GGCGGCGGCCATGGAGGCCGTGCTGAACGAGCTGGTGTCTGTGGAGGATCTGAAGAATTTTGAAAGGAAA TTTCAGTCTGAGCAGGCAGCTGGTTCTGTGTCCAAGAGCACGCAATTTGAATATGCCTGGTGCCTGGTTC GAAGCAAATACAATGAGGACATCCGCAGAGGCATCGTGCTGCTGGAGGAGCTGTTGCCCAAAGGGAGCAA AGAGGAACAGCGGGACTATGTCTTCTACCTGGCCGTGGGCAACTACCGGCTCAAGGAATATGAAAAGGCT CTAAAGTATGTGCGAGGGCTGTTGCAGACTGAGCCCCAGAACAACCAGGCCAAGGAGCTGGAACGCCTGA TTGATAAGGCCATGAAGAAAGATGGACTGGTAGGCATGGCCATCGTTGGTGGCATGGCCCTGGGCGTGGC AGGCCTGGCTGGACTCATTGGACTGGCTGTCTCCAAGTCCAAATCCTGAAGGCAGCCTCACCTGCTCTCT GCCCCGGGACGCCTAGGAGCCTGGGGGACACTGGAAGAGGGGCCTGTCCACCCTCACCATCGCCTTCCCG TTTCTCCTGCACCCCTGTAGTCTACCTCTACAGTCTCCATGACCCCCAGCCTCTTAGCCCCTGCACCTGT CGTTTAACCCTGTCATGCTTTGCAATGAGTGTAAATAAAATTGGGCCGTGGCTCGGGAAAAAAAAAAAAA AAA
Restriction Sites RsrII-NotI     
ACCN NM_025562
Insert Size 459 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC010783, AAH10783
RefSeq Size 773 bp
RefSeq ORF 459 bp
Locus ID 66437
UniProt ID Q9CQ92
Gene Summary Involved in the fragmentation of the mitochondrial network and its perinuclear clustering. Plays a minor role in the recruitment and association of the fission mediator dynamin-related protein 1 (DNM1L) to the mitochondrial surface and mitochondrial fission. May be not essential for the assembly of functional fission complexes and the subsequent membrane scission event. Can induce cytochrome c release from the mitochondrion to the cytosol, ultimately leading to apoptosis. Also mediates peroxisomal fission.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...