Apoa1 (BC012253) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	Alp-1; apo-AI; Apoa-1; apoA-I; Brp-14; Ltw-1; Lvtw-1; Sep-1; Sep-2; Sep2
Vector	PCMV6-Kan/Neo
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >BC012253 GCTCCGGGGAGGTCACCCACACCCTTCAGGATGAAAGCTGTGGTGCTGGCCGTGGCTCTGGTCTTCCTGA CAGGGAGCCAGGCTTGGCACGTATGGCAGCAAGATGAACCCCAGTCCCAATGGGACAAAGTGAAGGATTT CGCTAATGTGTATGTGGATGCGGTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAATCCTCCTCC TTGGGCCAACAGCTGAACCTGAATCTCCTGGAAAACTGGGACACTCTGGGTTCAACCGTTAGTCAGCTGC AGGAACGGCTGGGCCCATTGACTCGGGACTTCTGGGATAACCTGGAGAAAGAAACAGATTGGGTGAGACA GGAGATGAACAAGGACCTAGAGGAAGTGAAACAGAAGGTGCAGCCCTACCTGGACGAATTCCAGAAGAAA TGGAAAGAGGATGTGGAGCTCTACCGCCAGAAGGTGGCGCCTCTGGGCGCCGAGCTGCAGGAGAGCGCGC GCCAGAAGCTGCAGGAGCTGCAAGGGAGACTGTCCCCTGTGGCTGAGGAATTTCGCGACCGCATGCGCAC ACACGTAGACTCTCTGCGCACACAGCTAGCGCCCCACAGCGAACAGATGCGCGAGAGCCTGGCCCAGCGC CTGGCTGAGCTCAAGAGCAACCCTACCTTGAACGAGTACCACACCAGGGCCAAAACCCACCTGAAGACAC TTGGCGAGAAAGCCAGACCTGCGCTGGAGGACCTGCGCCATAGTCTGATGCCCATGCTGGAGACGCTTAA GACCAAAGCCCAGAGTGTGATCGACAAGGCCAGCGAGACTCTGACTGCCCAGTGAGGTGCCCGCTTCCAC TCCCCACCCCCGCATTGGCTTTCTTACAATAAACCTTTCCAAAATGGAAAAAAAAAAAAAAAA
Restriction Sites	RsrII-NotI
ACCN	BC012253
Insert Size	795 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	BC012253, AAH12253
RefSeq Size	903 bp
RefSeq ORF	795 bp
Locus ID	11806
Gene Summary	This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is the major protein component of plasma high density lipoprotein (HDL). This protein facilitates the removal of cholesterol and other fats from tissues by transporting them to the liver for excretion. This protein is a cofactor for lecithin cholesterolacyltransferase, an enzyme that catalyzes the conversion of free cholesterol to cholesteryl esters. Mutations in this gene in humans causes familial HDL deficiency, Tangier disease and familial visceral amyloidosis. Similar clinical features are exhibited by mice with mutations in this gene. This gene is clustered with three other apolipoprotein genes on chromosome 9. [provided by RefSeq, Dec 2013]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.