Pparg (NM_011146) Mouse Untagged Clone
CAT#: MC201042
Pparg (untagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2, (10ug)
CNY 3,768.00
Cited in 2 publications. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Nr1; Nr1c3; PPA; PPAR; Ppar-; PPAR-gamma; PPAR-gamma2; PPARgamma; PPARgamma2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC021798 sequence for NM_011146
CAAAACACCAGTGTGAATTACAGCAAATCTCTGTTTTATGCTGTTATGGGTGAAACTCTGGGAGATTCTC CTGTTGACCCAGAGCATGGTGCCTTCGCTGATGCACTGCCTATGAGCACTTCACAAGAAATTACCATGGT TGACACAGAGATGCCATTCTGGCCCACCAACTTCGGAATCAGCTCTGTGGACCTCTCCGTGATGGAAGAC CACTCGCATTCCTTTGACATCAAGCCCTTTACCACAGTTGATTTCTCCAGCATTTCTGCTCCACACTATG AAGACATTCCATTCACAAGAGCTGACCCAATGGTTGCTGATTACAAATATGACCTGAAGCTCCAAGAATA CCAAAGTGCGATCAAAGTAGAACCTGCATCTCCACCTTATTATTCTGAAAAGACCCAGCTCTACAACAGG CCTCATGAAGAACCTTCTAACTCCCTCATGGCCATTGAGTGCCGAGTCTGTGGGGATAAAGCATCAGGCT TCCACTATGGAGTTCATGCTTGTGAAGGATGCAAGGGTTTTTTCCGAAGAACCATCCGATTGAAGCTTAT TTATGATAGGTGTGATCTTAACTGCCGGATCCACAAAAAAAGTAGAAATAAATGTCAGTACTGTCGGTTT CAGAAGTGCCTTGCTGTGGGGATGTCTCACAATGCCATCAGGTTTGGGCGGATGCCACAGGCCGAGAAGG AGAAGCTGTTGGCGGAGATCTCCAGTGATATCGACCAGCTGAACCCAGAGTCTGCTGATCTGCGAGCCCT GGCAAAGCATTTGTATGACTCATACATAAAGTCCTTCCCGCTGACCAAAGCCAAGGCGAGGGCGATCTTG ACAGGAAAGACAACGGACAAATCACCATTTGTCATCTACGACATGAATTCCTTAATGATGGGAGAAGATA AAATCAAGTTCAAACATATCACCCCCCTGCAGGAGCAGAGCAAAGAGGTGGCCATCCGAATTTTTCAAGG GTGCCAGTTTCGATCCGTAGAAGCCGTGCAAGAGATCACAGAGTATGCCAAAAATATCCCTGGTTTCATT AACCTTGATTTGAATGACCAAGTGACTCTGCTCAAGTATGGTGTCCATGAGATCATCTACACGATGCTGG CCTCCCTGATGAATAAAGATGGAGTCCTCATCTCAGAGGGCCAAGGATTCATGACCAGGGAGTTCCTCAA AAGCCTGCGGAAGCCCTTTGGTGACTTTATGGAGCCTAAGTTTGAGTTTGCTGTGAAGTTCAATGCACTG GAATTAGATGACAGTGACTTGGCTATATTTATAGCTGTCATTATTCTCAGTGGAGACCGCCCAGGCTTGC TGAACGTGAAGCCCATCGAGGACATCCAAGACAACCTGCTGCAGGCCCTGGAACTGCAGCTCAAGCTGAA TCACCCAGAGTCCTCTCAGCTGTTCGCCAAGGTGCTCCAGAAGATGACAGACCTCAGGCAGATCGTCACA GAGCACGTGCAGCTACTGCATGTGATCAAGAAGACAGAGACAGACATGAGCCTTCACCCCCTGCTCCAGG AGATCTACAAGGACTTGTATTAGCAGGAAAGTCCCACCCGCTGACAACGTGTTCCTTCTATTGATTGCAC TATTATTTTGAGGGAAAAAAATCTGACACCTAAGAAATTTACTGTGAAAAAGCATTTAAAAACAAAAAGT TTTAGAACATGATCTATTTTATGCATATTGTTTATAAAGATACATTTACAATTTACTTTTAATATTAAAA ATTACCCCCTTATAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011146 |
Insert Size | 1518 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC021798, AAH21798 |
RefSeq Size | 1782 bp |
RefSeq ORF | 1518 bp |
Locus ID | 19016 |
UniProt ID | P37238 |
Gene Summary | This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015] Transcript Variant: This variant (2) encodes the longer isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Increasing endogenous PPARγ ligands improves insulin sensitivity and protects against diet-induced obesity without side effects of thiazolidinediones
,Tseng, Y;Chuang, L;Chang, Y;Hsieh, M;Tsou, L;Chen, S;Ke, Y;Hung, M;Hee, S;Lee, H;Nong, J;Hung, F;Huang, J;Kao, F;Yang, W;Chiu, C;Lin, S;Liu, B;Tai, C;Li, F;Chen, Y;Chou, Y;Cheng, J;Shih, Y;Hsu, C;Hwang, J;Yeh, T;Cheng, T;Chen, T;,
Research Square
[PPARG]
|
Evaluation of Teneligliptin Effects on Transcriptional Activity of PPARγ in Cell-Based Assays
,Takenaka, Y;Inoue, I;Nakano, T;Ikeda, M;Kakinuma, Y;Ikegami, Y;Shimada, A;Noda, M;,
J Nippon Med Sch
,PubMed ID 29731503
[PPARG]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG208132 | Pparg (tGFP-tagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg) |
CNY 5,360.00 |
|
MR208132 | Pparg (Myc-DDK-tagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2 |
CNY 3,760.00 |
|
MR208132L3 | Lenti ORF clone of Pparg (Myc-DDK-tagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2 |
CNY 6,460.00 |
|
MR208132L4 | Lenti ORF clone of Pparg (mGFP-tagged) - Mouse peroxisome proliferator activated receptor gamma (Pparg), transcript variant 2 |
CNY 6,160.00 |