United States
Germany
Japan
United Kingdom
China
Mad2l2 (NM_027985) Mouse Untagged Clone
CAT＃: MC200866
Mad2l2 (untagged) - Mouse MAD2 mitotic arrest deficient-like 2 (yeast) (Mad2l2), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2310033C13Rik; G1-453-4; MAD2B; repro22; REV7 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC011282 sequence for NM_027985
GCGCGTTAGGGGTCTCAGACGGTGGTTTCTATAGCCCGGTCGTAGATTGGAACCTGAGGTCGAAACCGGA GCCGGCGAATCGGGGAGGAGCGTAGAGAGGGCGGGATTTCCGCCGAGAGGGATCCGGCTGCTCAGGGGGC GGGGCTTCCCCCGACCGGGCTGCGTTTCCCGCGTGCGGGGTCGGTTGCCTTGAGTCCCTACAGACACCCT CCACGCCCTCCCCCAGGCGGCCAAGGATGACCACCCTCACGCGCCAAGACCTCAACTTTGGCCAAGTGGT GGCTGACGTGCTCTCCGAGTTCCTGGAGGTGGCCGTGCACCTGATTCTCTATGTGCGCGAGGTCTACCCG GTGGGCATCTTCCAGAAGCGCAAGAAGTACAACGTGCCGGTTCAGATGTCCTGTCATCCGGAGCTGAACC AGTACATCCAGGACACACTCCACTGCGTCAAACCTCTCCTGGAGAAGAACGATGTGGAGAAGGTGGTGGT GGTGATTTTGGATAAGGAACACCGCCCAGTGGAGAAGTTTGTCTTTGAGATCACTCAGCCTCCCTTGCTG TCCATCAATTCAGACTCCCTCCTGTCTCATGTGGAGCAGCTGCTTCGAGCCTTCATCCTTAAGATTAGTG TGTGTGATGCTGTCCTGGATCACAACCCTCCAGGCTGCACATTTACAGTCCTCGTGCACACAAGAGAAGC TGCTACTCGAAACATGGAGAAGATACAGGTCATCAAGGACTTCCCATGGATCCTGGCAGATGAACAGGAT GTCCACATGCACGACCCCCGCTTGATACCCCTAAAAACCATGACGTCGGACATTTTAAAGATGCAGCTCT ACGTTGAAGAGCGAGCGCATAAGAACAGCTGAGGACATGCCTGTCACCAGCTACCCAGCTGTCCCACTAC GGGGCCCCAGCCCGGGGCCCCAGACTCCAAGTGCTCTTATTGCCTTGACATGTGGCTGCCCCTCTGGTCA GGCTGCCCAGCCCTGCTTGCCTTCGTGAGGCAGCCTTCCCAGGAGCTGGGGAAGGATGCGAGGACACACG CCATTTCTCAGCAGCCTCCTGGGCTCAGCTGGCTAACATTGTCCACTGTGCCATGCGTTATTGTTAATAA AGTGGCCCCAAGGGCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_027985 |
| Insert Size | 636 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC011282, AAH11282 |
| RefSeq Size | 1176 bp |
| RefSeq ORF | 636 bp |
| Locus ID | 71890 |
| UniProt ID | Q9D752 |
| Gene Summary | Adapter protein able to interact with different proteins and involved in different biological processes. Mediates the interaction between the error-prone DNA polymerase zeta catalytic subunit REV3L and the inserter polymerase REV1, thereby mediating the second polymerase switching in translesion DNA synthesis. Translesion DNA synthesis releases the replication blockade of replicative polymerases, stalled in presence of DNA lesions. Component of the shieldin complex, which plays an important role in repair of DNA double-stranded breaks (DSBs). During G1 and S phase of the cell cycle, the complex functions downstream of TP53BP1 to promote non-homologous end joining (NHEJ) and suppress DNA end resection. Mediates various NHEJ-dependent processes including immunoglobulin class-switch recombination, and fusion of unprotected telomeres. May also regulate another aspect of cellular response to DNA damage through regulation of the JNK-mediated phosphorylation and activation of the transcriptional activator ELK1. Inhibits the FZR1- and probably CDC20-mediated activation of the anaphase promoting complex APC thereby regulating progression through the cell cycle. Regulates TCF7L2-mediated gene transcription and may play a role in epithelial-mesenchymal transdifferentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202284 | Mad2l2 (tGFP-tagged) - Mouse MAD2 mitotic arrest deficient-like 2 (yeast) (Mad2l2) |
CNY 2,850.00 |
|
| MR202284 | Mad2l2 (Myc-DDK-tagged) - Mouse MAD2 mitotic arrest deficient-like 2 (yeast) (Mad2l2) |
CNY 2,400.00 |
|
| MR202284L3 | Lenti ORF clone of Mad2l2 (Myc-DDK-tagged) - Mouse MAD2 mitotic arrest deficient-like 2 (yeast) (Mad2l2) |
CNY 4,750.00 |
|
| MR202284L4 | Lenti ORF clone of Mad2l2 (mGFP-tagged) - Mouse MAD2 mitotic arrest deficient-like 2 (yeast) (Mad2l2) |
CNY 4,750.00 |
