Cops6 (NM_012002) Mouse Untagged Clone

CAT#: MC200798

Cops6 (untagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 6 (Arabidopsis thaliana) (Cops6), (10ug)



  "NM_012002" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Sgn3; VIP/MOV34
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC014286 sequence for NM_012002
CCACGCGTCCGGAAAATGGCGGCGGCAGCTGCGGCGGGGGCGAATGGGAGCGGAGGCAGCAGCGGCATGG AAGTGGATGCAGCAGTCCCCAGCGTGATGGCCTCCGGAGTGACTGGGAGTGTTTCCGTCGCTCTTCATCC CCTTGTCATCCTTAACATCTCAGACCATTGGATCCGCATGCGCTCCCAGGAGGGGCGGCCTATGCAGGTG ATTGGGGCTCTGATCGGGAAGCAGGAGGGGCGAAATATCGAAGTGATGAACTCCTTTGAGCTGCTGTCCC ACACCGTGGAAGAGAAGATTATCATTGACAAAGAATATTATTACACCAAGGAGGAGCAGTTTAAACAGGT TTTCAAGGAGCTGGAGTTTCTGGGTTGGTATACCACAGGGGGGCCACCTGACCCCTCAGACATCCACGTC CATAAGCAGGTGTGTGAGATAATTGAGAGTCCGCTCTTTCTGAAGTTGAACCCTATGACCAAGCACACAG ATCTTCCTGTCAGCGTTTTTGAGTCTGTCATCGATATAATCAATGGAGAGGCCACAATGCTGTTTGCTGA GCTCACTTACACTCTGGCCACTGAGGAAGCTGAACGGATCGGTGTAGACCACGTGGCCCGGATGACAGCA ACAGGCAGTGGGGAGAACTCCACTGTGGCTGAACACCTGATAGCTCAGCATAGTGCCATCAAGATGCTGC ACAGCCGTGTGAAGCTCATTTTAGAATATGTCAAGGCCTCTGAAGCAGGAGAGGTTCCCTTCAACCATGA GATCCTGCGGGAGGCCTATGCCCTATGTCACTGTCTTCCAGTTCTCAGCACTGACAAGTTCAAGACAGAC TTTTATGATCAATGCAATGACGTGGGGCTCATGGCCTACCTCGGCACCATCACCAAAACGTGCAACACAA TGAACCAGTTTGTGAACAAGTTCAACGTCCTCTACGACCGACAAGGCATTGGCCGGCGAATGCGGGGACT GTTTTTCTGATGATGGTTCTGGAAGGGATGGTGTGTGGGGCTCAGACAGCTGTTCCATGGACCTGAGTAC CACATTCCCTTTAGAGAAACTCATTAATAAAAGAGCAGCCCCTTAGCAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_012002
Insert Size 975 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC014286, AAH14286
RefSeq Size 1135 bp
RefSeq ORF 975 bp
Locus ID 26893
UniProt ID O88545
Gene Summary Component of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. Has some glucocorticoid receptor-responsive activity (By similarity). Stabilizes COP1 through reducing COP1 auto-ubiquitination and decelerating COP1 turnover rate, hence regulates the ubiquitination of COP1 targets, including SFN (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...