Bsg (NM_001077184) Mouse Untagged Clone

CAT#: MC200670

Bsg (untagged) - Mouse basigin (Bsg), transcript variant 2, (10ug)



  "NM_001077184" in other vectors (4)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
CD147 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI115436; AI325119; CD147; EMMPRIN; HT-7
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC010270 sequence for NM_001077184
GACATGGCGGCGGCGCTGCTGCTGGCGCTGGCCTTCACGCTCTTGAGCGGCCAAGGCGCCTGCGCGGCGG CGGGCACCATCCAAACCTCGGTCCAGGAAGTCAACTCCAAAACACAGCTTACCTGCTCTTTGAACAGCAG TGGCGTTGACATCGTTGGCCACCGCTGGATGAGAGGTGGCAAGGTACTGCAGGAGGACACTCTGCCCGAC CTGCATACGAAGTACATAGTGGACGCAGATGACCGCTCTGGGGAATATTCCTGCATCTTCCTTCCTGAGC CTGTGGGCAGAAGCGAGATCAATGTGGAAGGGCCACCCAGGATCAAGGTCGGAAAGAAATCAGAGCATTC CAGTGAGGGAGAGCTTGCGAAACTGGTCTGCAAGTCCGATGCATCCTACCCTCCTATTACAGATTGGTTC TGGTTTAAGACCTCTGACACTGGGGAAGAAGAGGCAATCACCAATAGCACTGAAGCCAATGGCAAGTATG TGGTGGTATCCACGCCTGAGAAGTCACAGCTGACCATCAGCAACCTTGACGTAAATGTTGACCCTGGCAC CTACGTGTGTAATGCCACCAACGCCCAGGGCACTACTCGGGAAACCATCTCACTGCGTGTGCGGAGCCGC ATGGCAGCCCTCTGGCCCTTCCTAGGCATCGTGGCTGAGGTCCTGGTGTTGGTTACCATCATCTTTATCT ATGAGAAGAGGCGGAAGCCAGACCAGACCCTGGACGAGGATGACCCTGGCGCCGCCCCACTGAAGGGCAG TGGAACTCACATGAATGACAAGGACAAGAATGTACGCCAGAGGAACGCCACCTGAGTGGTGGGGCAGGCG GGGGAGGGGAGGTGCCCAGGGTGCCTGACCCCAGGCCAGCGTCTACCTCCACTCCAGTATCCCATCCTGT CCCAATTTGAACCTACCCAACCCAACCTATCCCAACCCAAGTGAAGACAGAGCCTTACCTTACAGAAAAC CCACCTGGAAGAAGCAAGCCACTTGCAGCCCCTGTTTCTAATTTAAACTAAATGAGGTTTCTATGCAGAC AATCCATTCCTTAGGGGTTTATGTTTTTATTTTTCCTTCCCTTCTGAAGTGTTGTCACTACAGCCCTGTG GAGTGGGGGAATGGGGCCTTGTCCTTGGTCAGGAGGGAAGGCCAGCGCATGCTCTGACTTACTGTTGGAG GGGGCTGGGCCTGCTGGAACCCCCCCAAATAAAGACCTACCCCACCAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_001077184
Insert Size 822 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC010270, AAH10270
RefSeq Size 1287 bp
RefSeq ORF 822 bp
Locus ID 12215
UniProt ID P18572
Gene Summary Plays an important role in targeting the monocarboxylate transporters SLC16A1, SLC16A3, SLC16A8, SLC16A11 and SLC16A12 to the plasma membrane. Plays pivotal roles in spermatogenesis, embryo implantation, neural network formation and tumor progression. Stimulates adjacent fibroblasts to produce matrix metalloproteinases (MMPS). Seems to be a receptor for oligomannosidic glycans. In vitro, promotes outgrowth of astrocytic processes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus when compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...