United States
Germany
Japan
United Kingdom
China
Ndufa8 (NM_026703) Mouse Untagged Clone
CAT＃: MC200654
Ndufa8 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 (Ndufa8), nuclear gene encoding mitochondrial protein, (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610033L03Rik; AW261656 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC012416 sequence for NM_026703
GGGCGACACGGCCGAGGGCACCTGGTCAGGGTCGCGGCTACCGCCGTCATGCCGGGGATAGTGGAGCTGC CAACTCTGGAAGAGCTGAAAGTGGAGGAGGTGAAAGTCAGCTCAGCTGTGCTTAAAGCTGCCGCCCATCA CTATGGGGCTCAGTGCGATAAAACCAATAAGGAGTTTATGCTGTGCCGCTGGGAAGAGAAGGACCCAAGG CGCTGCCTGAAGGAGGGCAAGCTGGTCAACGGCTGTGCGCTGAACTTCTTCAGGCAGATAAAGAGTCACT GTGCGGAGCCTTTCACAGAGTACTGGACTTGCCTTGATTACTCCAACATGCAGCTGTTTCGTCACTGCCG CCAGCAGCAGGCAAAGTTTGACCAGTGTGTGCTGGACAAACTGGGCTGGGTGAGGCCGGACCTGGGGCAG TTGTCTAAGGTCACCAAAGTGAAAACAGATCGTCCTTTGCCAGAGAATCCTTATCACTCAAGAGCAAGGC CAGAGCCCAACCCTGTGATTGAAGGGGATCTGAAACCCGCCAAGCACGGCACCCGCTTTTTTTTCTGGAC CGTGTAGAGATGGGTTGACGGTCCACACTTGGTCACCTCGGTCATGCGCCCAGACAACAGACGACGAAAA CACCCGTGCCGATCTCGTGTTCTTTCCTGGATCACAGACATTAACAAAAAAGTTAATTTATGTGACTTGG CAGTTATTCTATACATTTCCTGTCCATTAAAAATTTTAAAGGAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_026703 |
| Insert Size | 519 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC012416, AAH12416 |
| RefSeq Size | 759 bp |
| RefSeq ORF | 519 bp |
| Locus ID | 68375 |
| UniProt ID | Q9DCJ5 |
| Gene Summary | Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201450 | Ndufa8 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 (Ndufa8) |
CNY 2,850.00 |
|
| MR201450 | Ndufa8 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 (Ndufa8), nuclear gene encoding mitochondrial protein |
CNY 2,400.00 |
|
| MR201450L3 | Lenti ORF clone of Ndufa8 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 (Ndufa8), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
| MR201450L4 | Lenti ORF clone of Ndufa8 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8 (Ndufa8), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
