Banf1 (NM_011793) Mouse Untagged Clone

CAT#: MC200377

Banf1 (untagged) - Mouse barrier to autointegration factor 1 (Banf1), transcript variant 1, (10ug)



  "NM_011793" in other vectors (1)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Baf; Bcrp1; L2bp1/Baf
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC003709 sequence for NM_011793
GGAACCGTCTCGTAGCTTGAGGTCTGGGCGGGAGCGGCCGAGTGGCGCGAGGAGCCGTTACCAGAGCCGG AGCCTCCGGTTAAGCCTGATCACGATGACAACCTCCCAAAAGCACCGAGACTTCGTGGCAGAGCCCATGG GGGAAAAGCCAGTGGGGAGCCTGGCCGGGATTGGTGACGTCCTGAGCAAGAGGCTGGAGGAAAGGGGCTT TGACAAGGCTTATGTGGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGAGAATGG CTGAAGGATACATGTGGTGCCAATGCCAAGCAGTCCCGGGACTGCTTTGGGTGCCTTCGAGAATGGTGTG ATGCCTTCTTGTAGTGTTCTCTGGGGATCCCTCATACCCCAGCCACAGCACAGTTTCCAGAGTCTGCAGC AGGGCAGGGCTCCTCCCTGTCCTCCATAAAGGAAAAGATGGCTGTTGTCACCCTCACCTCCTATGTACTC CAGGGTCTATGGGGAGTTCTCTCCCCTCAGCGTTTCAATCTTTCTGGGATCGTTTCCCTTGCATGCCTTT CCCTTCCACCTCCCCCTGCAGTTCCGTGGCAGCAGTTACCAACTTTCCTGAATGGATTCCTGGCCCCCTT CTCCCTCACTATCTGTTGGATGCCCTTTGGCTCCTTTCCTTTTTTTGGCAAAAACAGTCACTGTCCTTAT AAAAGATTTTTAAATTAATAAAATCAGTGGCCTTCAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_011793
Insert Size 270 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC003709, AAH03709
RefSeq Size 756 bp
RefSeq ORF 270 bp
Locus ID 23825
UniProt ID O54962
Gene Summary Plays fundamental roles in nuclear assembly, chromatin organization, gene expression and gonad development. May potently compress chromatin structure and be involved in membrane recruitment and chromatin decondensation during nuclear assembly. Contains 2 non-specific dsDNA-binding sites which may promote DNA cross-bridging.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) differs in the 5' UTR, compared to variant 3. Variants 1-3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...