Eif4ebp1 (NM_007918) Mouse Untagged Clone

CAT#: MC200374

Eif4ebp1 (untagged) - Mouse eukaryotic translation initiation factor 4E binding protein 1 (Eif4ebp1), (10ug)



  "NM_007918" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Eif4ebp1 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4e-bp1; AA959816; PHAS-I
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002045 sequence for NM_007918
CGGACGCGTGGGCGGGGTTGCTGGAGGGTCGTGGGCGGCGTGCAGGAGACATGTCGGCGGGCAGCAGCTG CAGCCAGACTCCCAGCCGGGCCATCCCCACTCGCCGCGTAGCCCTCGGCGATGGCGTGCAGCTCCCGCCC GGGGACTACAGCACCACTCCGGGCGGCACGCTCTTCAGCACCACCCCGGGAGGAACCAGGATTATCTATG ACCGGAAATTTCTGATGGAGTGTCGGAACTCACCTGTGGCCAAAACACCCCCAAAGGACCTGCCAGCCAT TCCTGGGGTCACTAGCCCTACCAGCGATGAGCCTCCCATGCAAGCCAGCCAGAGCCAACTGCCCAGCAGC CCGGAAGATAAGCGGGCAGGCGGTGAAGAGTCACAATTTGAGATGGACATTTAAGGGACCAGCCGTAGGA CGCAATGATGCTTCTATGTCCCCCAAGGCCCTTGGGAGGAGAGCTGCACAGCATTCAGGCCTCATACCAG GCAGACACTGGGTGTGGGTCGGCCACCCAGTCCTGCTCCTCACTCAGGGTGCCAGCTCTGCCTTGAATTT TGTGAACACCAGCACATACCTCCTTGTGCCTCTGTCTATACCGAGCTGCTACTGCAGGGGAATGACTCTC ACTCACACCCTCCCTGCATGGAGCTCCAGCGAGTGGACTCAGAGGAGTCTATCAGAATGATCTGGCAATC CTAGCCCCAGCCTCCGGAGCACACCCATCTTTCCTTAGGCTGGGTTACCTGGGAAAGCCACACTTTTACT TCTTTCCCTGACAGGAAATAAAAGCCACATTTACCCTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007918
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC002045, AAH02045
RefSeq Size 823 bp
RefSeq ORF 354 bp
Locus ID 13685
UniProt ID Q60876
Gene Summary Repressor of translation initiation that regulates EIF4E activity by preventing its assembly into the eIF4F complex: hypophosphorylated form competes with EIF4G1/EIF4G3 and strongly binds to EIF4E, leading to repress translation. In contrast, hyperphosphorylated form dissociates from EIF4E, allowing interaction between EIF4G1/EIF4G3 and EIF4E, leading to initiation of translation (By similarity). Mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways (PubMed:7629182).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...