United States
Germany
Japan
United Kingdom
China
Eif4ebp1 (NM_007918) Mouse Untagged Clone
CAT＃: MC200374
Eif4ebp1 (untagged) - Mouse eukaryotic translation initiation factor 4E binding protein 1 (Eif4ebp1), (10ug)
CNY 1,200.00
CNY 2,000.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 4e-bp1; AA959816; PHAS-I |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002045 sequence for NM_007918
CGGACGCGTGGGCGGGGTTGCTGGAGGGTCGTGGGCGGCGTGCAGGAGACATGTCGGCGGGCAGCAGCTG CAGCCAGACTCCCAGCCGGGCCATCCCCACTCGCCGCGTAGCCCTCGGCGATGGCGTGCAGCTCCCGCCC GGGGACTACAGCACCACTCCGGGCGGCACGCTCTTCAGCACCACCCCGGGAGGAACCAGGATTATCTATG ACCGGAAATTTCTGATGGAGTGTCGGAACTCACCTGTGGCCAAAACACCCCCAAAGGACCTGCCAGCCAT TCCTGGGGTCACTAGCCCTACCAGCGATGAGCCTCCCATGCAAGCCAGCCAGAGCCAACTGCCCAGCAGC CCGGAAGATAAGCGGGCAGGCGGTGAAGAGTCACAATTTGAGATGGACATTTAAGGGACCAGCCGTAGGA CGCAATGATGCTTCTATGTCCCCCAAGGCCCTTGGGAGGAGAGCTGCACAGCATTCAGGCCTCATACCAG GCAGACACTGGGTGTGGGTCGGCCACCCAGTCCTGCTCCTCACTCAGGGTGCCAGCTCTGCCTTGAATTT TGTGAACACCAGCACATACCTCCTTGTGCCTCTGTCTATACCGAGCTGCTACTGCAGGGGAATGACTCTC ACTCACACCCTCCCTGCATGGAGCTCCAGCGAGTGGACTCAGAGGAGTCTATCAGAATGATCTGGCAATC CTAGCCCCAGCCTCCGGAGCACACCCATCTTTCCTTAGGCTGGGTTACCTGGGAAAGCCACACTTTTACT TCTTTCCCTGACAGGAAATAAAAGCCACATTTACCCTAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007918 |
| Insert Size | 354 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002045, AAH02045 |
| RefSeq Size | 823 bp |
| RefSeq ORF | 354 bp |
| Locus ID | 13685 |
| UniProt ID | Q60876 |
| Gene Summary | Repressor of translation initiation that regulates EIF4E activity by preventing its assembly into the eIF4F complex: hypophosphorylated form competes with EIF4G1/EIF4G3 and strongly binds to EIF4E, leading to repress translation. In contrast, hyperphosphorylated form dissociates from EIF4E, allowing interaction between EIF4G1/EIF4G3 and EIF4E, leading to initiation of translation (By similarity). Mediates the regulation of protein translation by hormones, growth factors and other stimuli that signal through the MAP kinase and mTORC1 pathways (PubMed:7629182).[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Effects of single amino acid deficiency on mRNA translation are markedly different for methionine versus leucine
,Mazor, KM;Dong, L;Mao, Y;Swanda, RV;Qian, SB;Stipanuk, MH;,
Sci Rep
,PubMed ID 29795412
[EIF4EBP1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200530 | Eif4ebp1 (tGFP-tagged) - Mouse eukaryotic translation initiation factor 4E binding protein 1 (Eif4ebp1) |
CNY 2,850.00 |
|
| MR200530 | Eif4ebp1 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E binding protein 1 (Eif4ebp1) |
CNY 1,200.00 |
|
| MR200530L3 | Lenti ORF clone of Eif4ebp1 (Myc-DDK-tagged) - Mouse eukaryotic translation initiation factor 4E binding protein 1 (Eif4ebp1) |
CNY 4,750.00 |
|
| MR200530L4 | Lenti ORF clone of Eif4ebp1 (mGFP-tagged) - Mouse eukaryotic translation initiation factor 4E binding protein 1 (Eif4ebp1) |
CNY 3,600.00 |
其它Eif4ebp1产品
