United States
Germany
Japan
United Kingdom
China
Fabp3 (NM_010174) Mouse Untagged Clone
CAT＃: MC200344
Fabp3 (untagged) - Mouse fatty acid binding protein 3, muscle and heart (Fabp3), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Fabph-1; Fabph-4; Fabph1; Fabph4; H-FABP; Mdgi |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002082 sequence for NM_010174
GTGCCTGCTCGCCTCCTCACTCATCGCACCATGGCGGACGCCTTTGTCGGTACCTGGAAGCTAGTGGACA GCAAGAATTTTGATGACTACATGAAGTCACTCGGTGTGGGCTTTGCCACCAGGCAGGTGGCTAGCATGAC CAAGCCTACTACCATCATCGAGAAGAACGGGGATACTATCACCATAAAGACACAAAGTACCTTCAAGAAC ACAGAGATCAACTTTCAGCTGGGAATAGAGTTCGACGAGGTGACAGCAGATGACCGGAAGGTCAAGTCAC TGGTGACGCTGGACGGAGGCAAACTCATCCATGTGCAGAAGTGGAACGGGCAGGAGACAACACTAACTAG GGAGCTAGTTGACGGGAAACTCATCCTGACTCTCACTCATGGCAGTGTGGTGAGCACTCGGACTTATGAG AAGGAGGCGTGACCTGGCTGCTCCGTCACTGACCGCCCGCTCCTCTGCCAACTGGCCACCCCTCAGCTCA GCACCATGCTGCCTCATGGTTTTCCCCTCTGACATTTTGTATAAACATTCTTGGGTTGGGATTTTTCTGG AGATACGGGGCATCAGCCTGGACCCAGTTCCTACTATGTATGTGGTTTATTTTTTAAAACTGTATCCAAA GGGTGCTCCAAGGTCAATAAAGCAGAACCAAGGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_010174 |
| Insert Size | 402 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002082, AAH02082 |
| RefSeq Size | 701 bp |
| RefSeq ORF | 402 bp |
| Locus ID | 14077 |
| UniProt ID | P11404 |
| Gene Summary | FABP are thought to play a role in the intracellular transport of long-chain fatty acids and their acyl-CoA esters.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200776 | Fabp3 (tGFP-tagged) - Mouse fatty acid binding protein 3, muscle and heart (Fabp3) |
CNY 2,800.00 |
|
| MR200776 | Fabp3 (Myc-DDK-tagged) - Mouse fatty acid binding protein 3, muscle and heart (Fabp3) |
CNY 1,200.00 |
|
| MR200776L3 | Lenti ORF clone of Fabp3 (Myc-DDK-tagged) - Mouse fatty acid binding protein 3, muscle and heart (Fabp3) |
CNY 4,750.00 |
|
| MR200776L4 | Lenti ORF clone of Fabp3 (mGFP-tagged) - Mouse fatty acid binding protein 3, muscle and heart (Fabp3) |
CNY 4,750.00 |
