Prpf19 (NM_134129) Mouse Untagged Clone

CAT#: MC200222

Prpf19 (untagged) - Mouse PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) (Prpf19), (10ug)



  "NM_134129" in other vectors (4)

CNY 3,760.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA617263; AL024362; D19Wsu55e; NMP200; Prp19; PSO4; Snev
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC004070 sequence for NM_134129
CCCACGTGAAGCAGTTGTGCGAGCATCGCCACGCTGGGCAGCTGTCTACCCGCGTCCGAGCGCTCCGGAA GCTGCGGGGGACCGGAAGTGGCCCGCGGAGGCTGCAGAGAACCGGGAACCCTCTGTGAGGCGACTGGCAG CAGCGCTACGACGGCGCCATGTCCCTGATCTGCTCGATCTCCAATGAAGTGCCAGAGCACCCGTGCGTGT CCCCTGTCTCTAATCATGTGTATGAGCGGCGACTCATTGAGAAGTACATTGCAGAGAATGGCACAGATCC TATCAACAACCAGCCTCTCTCAGAGGAGCAGCTCATCGACATCAAAGTTGCTCACCCAATCCGACCCAAG CCTCCCTCCGCCACCAGCATCCCAGCCATTCTGAAAGCCTTGCAGGATGAGTGGGATGCAGTCATGCTGC ACAGCTTCACTCTTCGCCAGCAACTGCAGACAACCCGCCAGGAGCTGTCCCATGCTCTGTACCAACACGA TGCTGCCTGCCGAGTCATTGCCCGGCTCACCAAAGAGGTCACTGCTGCTCGAGAAGCTCTGGCTACTCTG AAACCACAGGCTGGGCTTATTGTACCTCAGGCTGTGCCAAGCTCACAGCCCAGTGTTGTGGGTGCAGGAG AGCCCATGGATTTGGGTGAGCTGGTGGGAATGACCCCTGAGATTATCCAGAAGCTTCAAGACAAGGCTAC TGTGCTAACCACAGAGCGTAAGAAGAGAGGAAAGACTGTCCCCGAGGAGCTGGTGAAACCTGAAGAGCTC AGCAAGTACCGGCAGGTGGCATCCCATGTGGGGCTACACAGTGCTAGCATTCCTGGGATTCTCGCTCTGG ACCTGTGTCCCTCAGACACCAACAAGATTCTCACTGGTGGGGCAGATAAAAATGTTGTTGTCTTTGATAA GAGTACTGAGCAAATATTGGCCACTCTCAAAGGCCATACCAAGAAGGTCACCAGTGTGGTGTTTCATCCT TCTCAGGAACTGGTGTTTTCTGCGTCCCCTGATGCTACTATCAGGATTTGGTCAGTCCCGAACACTTCCT GCGTACAGGTTGTTCGGGCCCATGAGAGTGCAGTGACAGGCCTCAGCCTCCATGCTACTGGAGACTATCT CCTGAGCTCCTCTGATGATCAGTACTGGGCCTTCTCTGACATCCAGACAGGGCGTGTGCTCACTAAGGTG ACAGATGAGACCTCCGGCTGCTCTCTTACCTGTGCACAGTTCCACCCTGATGGGCTCATCTTTGGAACAG GAACCATGGACTCCCAGATCAAGATCTGGGACTTGAAGGAGCGTACCAATGTGGCCAACTTCCCTGGCCA CTCTGGCCCCATTACCAGCATCGCCTTCTCTGAGAATGGGTACTACCTGGCCACAGCAGCTGATGATTCC TCAGTCAAGCTCTGGGACTTACGCAAGTTGAAGAACTTCAAGACATTGCAGCTGGACAACAACTTTGAGG TGAAGTCACTAATCTTTGACCAGAGCGGTACCTACCTGGCGCTTGGGGGTACAGATGTCCAGATCTACAT CTGCAAACAATGGACAGAGATTCTTCACTTTACAGAGCACAGTGGCCTGACCACTGGAGTGGCCTTTGGA CACCATGCCAAGTTCATCGCTTCAACTGGCATGGACAGGAGCCTCAAATTCTACAGTCTGTAGGCCCTAT GCCTTCTCACAGTTCTGGGCCTCATCTCAGTAGTGGGTTAGAGTTAGAGGGTGGGGGTGGGGGTGGGACT TTAGGAGGAGAGGGAGGTCTGGTTGGGGGGGGACATTCACATCATTTCATTTTGGTCTGGATGATGGTCT GAGCCAGGGCACATAGAACACTGCTATCCATGCAGCCTTTGGGCCCCAGGGAACGGTCACCCTGTAAAGT GCTCAGAGTCGGAGTCCAGCACCTCCCCCAGTGGTGGCAGCTGTTCCATGCCTGCTCTGTTTCAGCTCTT CTGAGACAGGGAGGAGGAGCCAAGGGAGCTGTGAAGGGGAGGGGCAGGAGGACTCTTGCAGGGTTTTGTA AGCAGCGATCTAGTTTCATTAAAAAAAAAAAGCTACACAGTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_134129
Insert Size 1515 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC004070, AAH04070
RefSeq Size 2087 bp
RefSeq ORF 1515 bp
Locus ID 28000
UniProt ID Q99KP6
Gene Summary Isoform 1: Ubiquitin-protein ligase which is a core component of several complexes mainly involved in pre-mRNA splicing and DNA repair. Required for pre-mRNA splicing as component of the spliceosome. Core component of the PRP19C/Prp19 complex/NTC/Nineteen complex which is part of the spliceosome and participates in its assembly, its remodeling and is required for its activity. During assembly of the spliceosome, mediates 'Lys-63'-linked polyubiquitination of the U4 spliceosomal protein PRPF3. Ubiquitination of PRPF3 allows its recognition by the U5 component PRPF8 and stabilizes the U4/U5/U6 tri-snRNP spliceosomal complex. Recruited to RNA polymerase II C-terminal domain (CTD) and the pre-mRNA, it may also couple the transcriptional and spliceosomal machineries. The XAB2 complex, which contains PRPF19, is also involved in pre-mRNA splicing, transcription and transcription-coupled repair. Beside its role in pre-mRNA splicing PRPF19, as part of the PRP19-CDC5L complex, plays a role in the DNA damage response/DDR. It is recruited to the sites of DNA damage by the RPA complex where PRPF19 directly ubiquitinates RPA1 and RPA2. 'Lys-63'-linked polyubiquitination of the RPA complex allows the recruitment of the ATR-ATRIP complex and the activation of ATR, a master regulator of the DNA damage response. May also play a role in DNA double-strand break (DSB) repair by recruiting the repair factor SETMAR to altered DNA. As part of the PSO4 complex may also be involved in the DNA interstrand cross-links/ICLs repair process. In addition, may also mediate 'Lys-48'-linked polyubiquitination of substrates and play a role in proteasomal degradation (PubMed:17349974). May play a role in the biogenesis of lipid droplets (PubMed:17118936). May play a role in neural differentiation possibly through its function as part of the spliceosome (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...