Spsb2 (NM_013539) Mouse Untagged Clone

CAT#: MC200175

Spsb2 (untagged) - Mouse splA/ryanodine receptor domain and SOCS box containing 2 (Spsb2), (10ug)



  "NM_013539" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI461677; C9; Grcc; Grcc9; SS; SSB2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002005 sequence for NM_013539
GGAGGGACAAGAGGTTACCCACTCAAAGAGTGTGCTCCACAAAGCATGCGCGCTTGTCCACGTCTGGAGT CGTCACTTATTTTTTGCCTGGATTCTTTGTAGCCGGGGACGATCCGGAGCTCAACTTTCAAAAGCGAGAC GCCCCAGCAAGCCTGTTTTGAGAAGTTCTTCAGCGGCTCTCCTCATGGGCCAGACGGCCCTGGCAAGGGG CAGCAGCAGCACCCCTACCTCGCAGGCTCTGTACTCGGACTTCTCTCCTCCCGAGGGCTTGGAGGAGCTC CTGTCTGCTCCCCCTCCTGACCTGGTTGCCCAACGGCACCACGGCTGGAACCCCAAGGATTGCTCCGAGA ACATCGATGTCAAGGAAGGGGGTCTGTGCTTTGAGCGGCGCCCTGTGGCCCAGAGCACTGATGGAGTCCG GGGGAAACGGGGCTATTCGAGAGGTCTGCACGCCTGGGAGATCAGCTGGCCCCTGGAGCAAAGGGGCACA CACGCCGTGGTGGGCGTGGCCACCGCCCTCGCCCCGCTGCAGGCTGACCACTATGCGGCGCTTTTGGGCA GCAACAGCGAGTCCTGGGGCTGGGATATTGGGCGGGGAAAATTGTATCATCAGAGTAAGGGCCTCGAGGC CCCCCAGTATCCAGCTGGACCTCAGGGTGAGCAGCTAGTGGTGCCAGAGAGACTGCTGGTGGTTCTGGAC ATGGAGGAGGGGACTCTTGGCTACTCTATTGGGGGCACGTACCTGGGACCAGCCTTCCGTGGACTGAAGG GGAGGACCCTCTATCCCTCTGTAAGTGCTGTTTGGGGCCAGTGCCAGGTCCGCATCCGCTACATGGGCGA AAGAAGAGTGGAGGAACCACAATCCCTTCTGCACCTGAGCCGCCTGTGTGTGCGCCATGCTCTGGGGGAC ACCCGGCTGGGTCAAATATCCACTCTGCCTTTGCCCCCTGCCATGAAGCGCTATCTGCTCTACAAATGAC CCAGTAGTACAGGGTGTGCTGGCACCCTACCGTGGGGACAGGTGGAGAGGCACCCGCTGGCCTAGACAAC TTTAAAAAGCTGGTGAAGCTGGGGGGGGGGGGCTGGACCCCTTCACCTCCCCTTCTCACAGGAGCAAGAC ATATAGAAATGATATTAAACACCATGGCAGCCTGGGACAAAGAGGTTTTTGAAGTAAAAAATGAGATGTA TTGTCAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_013539
Insert Size 795 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC002005, AAH02005
RefSeq Size 1212 bp
RefSeq ORF 795 bp
Locus ID 14794
UniProt ID O88838
Gene Summary This gene encodes a member of the SSB family of proteins that contain a central SPRY (repeats in splA and ryanodine receptors) domain and a C-terminal SOCS (suppressor of cytokine signaling) box. The encoded protein is an adaptor protein in the E3 ubiquitin ligase complex that ubiquitinates inducible nitric oxide synthase and targets it for proteasomal degradation. Mice lacking the encoded protein exhibit lower blood urea nitrogen levels and mild thrombocytopenia due to reduced platelet production. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1, 2, 3 and 4 encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...