United States
Germany
Japan
United Kingdom
China
Mapk13 (NM_011950) Mouse Untagged Clone
CAT＃: MC200120
Mapk13 (untagged) - Mouse mitogen-activated protein kinase 13 (Mapk13), (10ug)
CNY 3,656.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | SAPK4; Serk4 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC001992 sequence for NM_011950
GGCCGGGAGCCCGCGGGCAGCCACCGCAACCTCCTCGCAGGACCGCCACCACGGGGTCCGGGATGAGCCT CACTCGGAAAAGGGGCTTCTACAAGCAGGACATCAACAAGACTGCCTGGGAGCTACCCAAGACCTACCTG GCGCCCGCGCACGTCGGCAGCGGGGCCTATGGAGCGGTGTGCTCGGCCATCGACAAGCGGACAGGGGAGA AGGTGGCCATCAAGAAGCTGAGCCGGCCCTTCCAGTCGGAGATCTTTGCCAAGCGCGCTTACCGCGAGCT TCTGCTCTTGAAGCACATGCACCATGAGAACGTCATTGGGCTTCTGGATGTCTTCACCCCTGCGTCTTCC CTTCGGAGCTTCCATGATTTCTACCTGGTGATGCCCTTCATGCAGACAGACCTACAGAAGATCATGGGGA TGGAATTCAGCGAGGATAAGGTCCAGTACTTGGTGTACCAGATGCTCAAAGGTCTAAAGTACATCCACTC CGCTGGCATCGTCCACAGGGACCTGAAACCGGGCAACCTGGCTGTGAATGAAGACTGTGAGCTGAAGATC CTGGACTTTGGGCTGGCCCGCCACACAGACACTGAGATGACGGGCTATGTGGTGACCCGCTGGTACCGGG CCCCCGAGGTGATCCTCAGCTGGATGCATTACAACCAGACAGTCGACATCTGGTCTGTTGGTTGCATCAT GGCAGAAATGCTGACTGGAAAGACACTCTTCAAGGGCAAGGACTACCTGGACCAGCTGACCCAGATCCTG AAAGTGACTGGGGTGCCAGGTGCCGAGTTCGTGCAGAAGCTGAAAGACAAGGCGGCCAAATCCTATATTC AGTCCCTGCCCCAGAGCCCCAAGAAGGATTTCACACAGCTCTTTCCACGCGCCAGTCCGCAAGCTGCAGA CCTGCTCGACAAGATGCTGGAGCTGGATGTGGACAAGCGTCTGACCGCTGCTCAGGCACTGGCTCACCCC TTCTTTGAACCCTTCCGGGACCCTGAGGAGGAGACAGAGGCCCAGCAGCCTTTTGATGATGCCTTAGAAC ATGAGAAACTCAGTGTGGACGAATGGAAACAACACATCTACAAAGAGATCTCAAACTTCAGTCCCATAGC CCGGAAGGACTCACGGCGACGAAGTGGCATGAAGCTGCAGTGACTGATGGCTGGCCTCCATGTAGCCCAG GTTGGCCTCCATGTAGCCCAGGCTGGCCTTGAGTCTTCCTCCTCTCCTTTTTTGAGTCAGGATCTTACTG TGTAGCCCTGGAGCCCTGGCTAGACCTGCAACTCAAGAGATCCACCCACCTCTGTTACCTGGGTGGTGGG ATTAAAGGCATGCACCACTGAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_011950 |
| Insert Size | 1101 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC001992, AAH01992 |
| RefSeq Size | 1376 bp |
| RefSeq ORF | 1101 bp |
| Locus ID | 26415 |
| UniProt ID | Q9Z1B7 |
| Gene Summary | Serine/threonine kinase which acts as an essential component of the MAP kinase signal transduction pathway. MAPK13 is one of the four p38 MAPKs which play an important role in the cascades of cellular responses evoked by extracellular stimuli such as proinflammatory cytokines or physical stress leading to direct activation of transcription factors such as ELK1 and ATF2. Accordingly, p38 MAPKs phosphorylate a broad range of proteins and it has been estimated that they may have approximately 200 to 300 substrates each. MAPK13 is one of the less studied p38 MAPK isoforms. Some of the targets are downstream kinases such as MAPKAPK2, which are activated through phosphorylation and further phosphorylate additional targets. Plays a role in the regulation of protein translation by phosphorylating and inactivating EEF2K. Involved in cytoskeletal remodeling through phosphorylation of MAPT and STMN1. Mediates UV irradiation induced up-regulation of the gene expression of CXCL14. Plays an important role in the regulation of epidermal keratinocyte differentiation, apoptosis and skin tumor development. Phosphorylates the transcriptional activator MYB in response to stress which leads to rapid MYB degradation via a proteasome-dependent pathway. MAPK13 also phosphorylates and down-regulates PRKD1 during regulation of insulin secretion in pancreatic beta cells.[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Occludin is regulated by epidermal growth factor receptor activation in brain endothelial cells and brains of mice with acute liver failure
,null,
Hepatology (Baltimore, Md.)
,PubMed ID 21480332
[Mapk13]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR205630 | Mapk13 (Myc-DDK-tagged) - Mouse mitogen-activated protein kinase 13 (Mapk13) |
CNY 3,656.00 |
|
| MR205630L3 | Lenti ORF clone of Mapk13 (Myc-DDK-tagged) - Mouse mitogen-activated protein kinase 13 (Mapk13) |
CNY 4,750.00 |
|
| MR205630L4 | Lenti ORF clone of Mapk13 (mGFP-tagged) - Mouse mitogen-activated protein kinase 13 (Mapk13) |
CNY 4,750.00 |
