United States
Germany
Japan
United Kingdom
China
Lgals1 (NM_008495) Mouse Untagged Clone
CAT＃: MC200092
Lgals1 (untagged) - Mouse lectin, galactose binding, soluble 1 (Lgals1), (10ug)
CNY 1,200.00
CNY 2,000.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AA410090; Gal-1; Galbp; galectin-1; L-14.5; L14; Lect14 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002063 sequence for NM_008495
CCCACGCGTCCGCTTCTGACTGCTGGTGGAGCAGGTCTCAGGAATCTCTTCGCTTCAGCTTCAATCATGG CCTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGGGAATGTCTCAAAGTTCGGGGAGAGGTGGC CTCGGACGCCAAGAGCTTTGTGCTGAACCTGGGAAAAGACAGCAACAACCTGTGCCTACACTTCAATCCT CGCTTCAATGCCCATGGAGACGCCAACACCATTGTGTGTAACACCAAGGAAGATGGGACCTGGGGAACCG AACACCGGGAACCTGCCTTCCCCTTCCAGCCCGGGAGCATCATAGAGGTGTGCATCACCTTTGACCAGGC TGACCTGACCATCAAGCTGCCAGACGGACATGAATTCAAGTTCCCCAACCGCCTCAACATGGAGGCCATC AACTACATGGCGGCGGATGGAGACTTCAAGATTAAGTGCGTGGCCTTTGAGTGAAGCCAGCCAGCCTGTA GCCCTCAATAAAGGCAGCTGCCTCTGCTCCCCATAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_008495 |
| Insert Size | 408 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002063, AAH02063 |
| RefSeq Size | 539 bp |
| RefSeq ORF | 408 bp |
| Locus ID | 16852 |
| UniProt ID | P16045 |
| Gene Summary | Lectin that binds beta-galactoside and a wide array of complex carbohydrates. Plays a role in regulating apoptosis, cell proliferation and cell differentiation. Inhibits CD45 protein phosphatase activity and therefore the dephosphorylation of Lyn kinase. Strong inducer of T-cell apoptosis.[UniProtKB/Swiss-Prot Function] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A novel miR1983-TLR7-IFNβ circuit licenses NK cells to kill glioma cells, and is under the control of galectin-1
,null,
Oncoimmunology
,PubMed ID 34249474
[Lgals1]
|
|
Natural Killer Cells Eradicate Galectin-1 Deficient Glioma in the Absence of Adaptive Immunity
,Baker, GJ;Chockley, P;Yadav, VN;Doherty, R;Ritt, M;Sivaramakrishnan, S;Castro, MG;Lowenstein, PR;,
Cancer Res. July 2014
,PubMed ID 25038230
[Lgals1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200810 | Lgals1 (tGFP-tagged) - Mouse lectin, galactose binding, soluble 1 (Lgals1) |
CNY 2,800.00 |
|
| MR200810 | Lgals1 (Myc-DDK-tagged) - Mouse lectin, galactose binding, soluble 1 (Lgals1) |
CNY 1,200.00 |
|
| MR200810L3 | Lenti ORF clone of Lgals1 (Myc-DDK-tagged) - Mouse lectin, galactose binding, soluble 1 (Lgals1) |
CNY 4,750.00 |
|
| MR200810L4 | Lenti ORF clone of Lgals1 (mGFP-tagged) - Mouse lectin, galactose binding, soluble 1 (Lgals1) |
CNY 3,600.00 |
