FOXP2 (NM_148899) Human 3' UTR Clone

CAT#: SC212501

3' UTR clone of forkhead box P2 (FOXP2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FOXP2 (NM_148899) Human 3' UTR Clone
Vector pMirTarget
Synonyms CAGH44; SPCH1; TNRC10
ACCN NM_148899
Insert Size 131 bp
Sequence Data
>SC212501 3’UTR clone of NM_148899
The sequence shown below is from the reference sequence of NM_148899. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGTGCATATTGCTTTATAAACAGTAAATAGCTCTACCAATGTAACAGACTAAGAAAATGAACAATTTAG
TGACAGTTAGAAAACAATGAGTGTGATGAAAAATACGGCAATAAAATGAAAGTAAAATGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_148899.3
Synonyms CAGH44; SPCH1; TNRC10
Summary This gene encodes a member of the forkhead/winged-helix (FOX) family of transcription factors. It is expressed in fetal and adult brain as well as in several other organs such as the lung and gut. The protein product contains a FOX DNA-binding domain and a large polyglutamine tract and is an evolutionarily conserved transcription factor, which may bind directly to approximately 300 to 400 gene promoters in the human genome to regulate the expression of a variety of genes. This gene is required for proper development of speech and language regions of the brain during embryogenesis, and may be involved in a variety of biological pathways and cascades that may ultimately influence language development. Mutations in this gene cause speech-language disorder 1 (SPCH1), also known as autosomal dominant speech and language disorder with orofacial dyspraxia. Multiple alternative transcripts encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Locus ID 93986
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...