GRHL3 (NM_198174) Human 3' UTR Clone

CAT#: SC210396

3' UTR clone of grainyhead-like 3 (Drosophila) (GRHL3) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GRHL3 (NM_198174) Human 3' UTR Clone
Vector pMirTarget
Synonyms SOM; TFCP2L4; VWS2
ACCN NM_198174
Insert Size 141 bp
Sequence Data
>SC210396 3’UTR clone of NM_198174
The sequence shown below is from the reference sequence of NM_198174. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCCTGCACTTCACTGTAAACTCGGAATGACACACCCACCTGGAGGAGAGGTGGAAGGACGACGGCAGG
TCACATCTGAGAGCTCTCAGCTCAGAGTATGTGGCCCCTGAATACATTCTGGCTATTACTTTGCATTTA
AAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_198174.3
Synonyms SOM; TFCP2L4; VWS2
Summary This gene encodes a member of the grainyhead family of transcription factors. The encoded protein may function as a transcription factor during development, and has been shown to stimulate migration of endothelial cells. Multiple transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Aug 2010]
Locus ID 57822
MW 5.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...