ERK1 (MAPK3) (NM_001040056) Human 3' UTR Clone

CAT#: SC210265

3' UTR clone of mitogen-activated protein kinase 3 (MAPK3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ERK1 (MAPK3) (NM_001040056) Human 3' UTR Clone
Vector pMirTarget
Synonyms ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3
ACCN NM_001040056
Insert Size 30 bp
Sequence Data
>SC210265 3’UTR clone of NM_001040056
The sequence shown below is from the reference sequence of NM_001040056. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGGGGCAGGGGAGCAGGGGGGCACGTAG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001040056.3
Synonyms ERK-1; ERK1; ERT2; HS44KDAP; HUMKER1A; p44-ERK1; p44-MAPK; P44ERK1; P44MAPK; PRKM3
Summary The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 5595
MW 0.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...