Tristetraprolin (ZFP36) (NM_003407) Human 3' UTR Clone

CAT#: SC209121

3' UTR clone of zinc finger protein 36 C3H type homolog (mouse) (ZFP36) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Tristetraprolin (ZFP36) (NM_003407) Human 3' UTR Clone
Vector pMirTarget
Synonyms G0S24; GOS24; NUP475; RNF162A; TIS11; TTP; zfp-36
ACCN NM_003407
Insert Size 738 bp
Sequence Data
>SC209121 3’UTR clone of NM_003407
The sequence shown below is from the reference sequence of NM_003407. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCTTCAATCGCATCTCTGTTTCTGAGTGACAAAGTGACTGCCCGGTCAGATCAGCTGGATCTCAGCGG
GGAGCCACGTCTCTTGCACTGTGGTCTCTGCATGGACCCCAGGGCTGTGGGGACTTGGGGGACAGTAAT
CAAGTAATCCCCTTTTCCAGAATGCATTAACCCACTCCCCTGACCTCACGCTGGGGCAGGTCCCCAAGT
GTGCAAGCTCAGTATTCATGATGGTGGGGGATGGAGTGTCTTCCGAGGTTCTTGGGGGAAAAAAAATTG
TAGCATATTTAAGGGAGGCAATGAACCCTCTCCCCCACCTCTTCCCTGCCCAAATCTGTCTCCTAGAAT
CTTATGTGCTGTGAATAATAGGCCTTCACTGCCCCTCCAGTTTTTATAGACCTGAGGTTCCAGTGTCTC
CTGGTAACTGGAACCTCTCCTGAGGGGGAATCCTGGTGCTCAAATTACCCTCCAAAAGCAAGTAGCCAA
AGCCGTTGCCAAACCCCACCCATAAATCAATGGGCCCTTTATTTATGACGACTTTATTTATTCTAATAT
GATTTTATAGTATTTATATATATTGGGTCGTCTGCTTCCCTTGTATTTTTCTTCCTTTTTTTGTAATAT
TGAAAACGACGATATAATTATTATAAGTAGACTATAATATATTTAGTAATATATATTATTACCTTAAAA
GTCTATTTTTGTGTTTTGGGCATTTTTAAATAAACAATCTGAGTGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003407.5
Synonyms G0S24; GOS24; NUP475; RNF162A; TIS11; TTP; zfp-36
Summary Zinc-finger RNA-binding protein that destabilizes several cytoplasmic AU-rich element (ARE)-containing mRNA transcripts by promoting their poly(A) tail removal or deadenylation, and hence provide a mechanism for attenuating protein synthesis (PubMed:9703499, PubMed:10330172, PubMed:10751406, PubMed:11279239, PubMed:12115244, PubMed:12748283, PubMed:15187101, PubMed:15634918, PubMed:17030620, PubMed:16702957, PubMed:20702587, PubMed:20221403, PubMed:21775632, PubMed:27193233, PubMed:23644599, PubMed:25815583). Acts as an 3'-untranslated region (UTR) ARE mRNA-binding adapter protein to communicate signaling events to the mRNA decay machinery (PubMed:15687258, PubMed:23644599). Recruits deadenylase CNOT7 (and probably the CCR4-NOT complex) via association with CNOT1, and hence promotes ARE-mediated mRNA deadenylation (PubMed:23644599). Functions also by recruiting components of the cytoplasmic RNA decay machinery to the bound ARE-containing mRNAs (PubMed:11719186, PubMed:12748283, PubMed:15687258, PubMed:16364915). Self regulates by destabilizing its own mRNA (PubMed:15187101). Binds to 3' UTR ARE of numerous mRNAs and of its own mRNA (PubMed:10330172, PubMed:10751406, PubMed:12115244, PubMed:15187101, PubMed:15634918, PubMed:17030620, PubMed:16702957, PubMed:19188452, PubMed:20702587, PubMed:20221403, PubMed:21775632, PubMed:25815583). Plays a role in anti-inflammatory responses; suppresses tumor necrosis factor (TNF)-alpha production by stimulating ARE-mediated TNF-alpha mRNA decay and several other inflammatory ARE-containing mRNAs in interferon (IFN)- and/or lipopolysaccharide (LPS)-induced macrophages (By similarity). Plays also a role in the regulation of dendritic cell maturation at the post-transcriptional level, and hence operates as part of a negative feedback loop to limit the inflammatory response (PubMed:18367721). Promotes ARE-mediated mRNA decay of hypoxia-inducible factor HIF1A mRNA during the response of endothelial cells to hypoxia (PubMed:21775632). Positively regulates early adipogenesis of preadipocytes by promoting ARE-mediated mRNA decay of immediate early genes (IEGs) (By similarity). Negatively regulates hematopoietic/erythroid cell differentiation by promoting ARE-mediated mRNA decay of the transcription factor STAT5B mRNA (PubMed:20702587). Plays a role in maintaining skeletal muscle satellite cell quiescence by promoting ARE-mediated mRNA decay of the myogenic determination factor MYOD1 mRNA (By similarity). Associates also with and regulates the expression of non-ARE-containing target mRNAs at the post-transcriptional level, such as MHC class I mRNAs (PubMed:18367721). Participates in association with argonaute RISC catalytic components in the ARE-mediated mRNA decay mechanism; assists microRNA (miRNA) targeting ARE-containing mRNAs (PubMed:15766526). May also play a role in the regulation of cytoplasmic mRNA decapping; enhances decapping of ARE-containing RNAs, in vitro (PubMed:16364915). Involved in the delivery of target ARE-mRNAs to processing bodies (PBs) (PubMed:17369404). In addition to its cytosolic mRNA-decay function, affects nuclear pre-mRNA processing (By similarity). Negatively regulates nuclear poly(A)-binding protein PABPN1-stimulated polyadenylation activity on ARE-containing pre-mRNA during LPS-stimulated macrophages (By similarity). Also involved in the regulation of stress granule (SG) and P-body (PB) formation and fusion (By similarity). Plays a role in the regulation of keratinocyte proliferation, differentiation and apoptosis (PubMed:27182009). Plays a role as a tumor suppressor by inhibiting cell proliferation in breast cancer cells (PubMed:26926077).[UniProtKB/Swiss-Prot Function]
Locus ID 7538
MW 28
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...