MTA2 (NM_004739) Human 3' UTR Clone

CAT#: SC208733

3' UTR clone of metastasis associated 1 family member 2 (MTA2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MTA2 (NM_004739) Human 3' UTR Clone
Vector pMirTarget
Synonyms MTA1L1; PID
ACCN NM_004739
Insert Size 691 bp
Sequence Data
>SC208733 3’UTR clone of NM_004739
The sequence shown below is from the reference sequence of NM_004739. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCAATGAGCCTATTGTCCTGGAGGACTGAGCACCTGTGGGGAAGGGAGGTGGGCTGAGAGGTAGAGGG
TGGATGCCCAGGGCACCCAAACCTCCCTTCCCTTTCGTGTCGAAGGGAGTGAGGAGTGAATTAAGGAAG
AGAGCAAGTGAGTGTGTGTCCCTGGAGGGGTTGGGCGCCCTCTGGTGTTACCACCTCGAGACTTGTCTC
ATGCCTCCATGCTTGCCGATGGAGGACAGACTGCAGGAACTTGGCCCATGTGGGAACCTAGCCTGTTTT
GGGGGGTAGGACCCACAGATGTCTTGGACAGTTTTGGGGGGAGGGTTTTTTAATTTTTTAAAAATTTTG
CCTCCCTTTGTGAAAGGGGATGGGGAGGGGAAGAGTAAACAGATAACAGGTGGTGGTACCTGGTTGGGG
GAGGGGGGCGTGCACTGCCATGTCTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTAATTGGGGGTTTCTC
TTTCTGTCCGGTGTCCGGACTTTCCTAATTGGAGTTTGAGGCCCCTAAGCTGGCATCAACCCCAGGCCA
CGCTCGCTCTTTCCTTCCCTCCCCTCCCCCTCTGCCTTTTGTACGCCAGTTCTCAGAAATAAAGATCTT
TTGTCCGTTTTTTTAACCTCGGATTCTGTAATTGGTTCTTATAGTAACAAATAAAAAGCTGTTTTCTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004739.4
Synonyms MTA1L1; PID
Summary This gene encodes a protein that has been identified as a component of NuRD, a nucleosome remodeling deacetylase complex identified in the nucleus of human cells. It shows a very broad expression pattern and is strongly expressed in many tissues. It may represent one member of a small gene family that encode different but related proteins involved either directly or indirectly in transcriptional regulation. Their indirect effects on transcriptional regulation may include chromatin remodeling. It is closely related to another member of this family, a protein that has been correlated with the metastatic potential of certain carcinomas. These two proteins are so closely related that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. One of the proteins known to be a target protein for this gene product is p53. Deacetylation of p53 is correlated with a loss of growth inhibition in transformed cells supporting a connection between these gene family members and metastasis. [provided by RefSeq, May 2011]
Locus ID 9219
MW 25.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...