Angiotensinogen (AGT) (NM_000029) Human 3' UTR Clone

CAT#: SC208213

3' UTR clone of angiotensinogen (serpin peptidase inhibitor clade A member 8) (AGT) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Angiotensinogen (AGT) (NM_000029) Human 3' UTR Clone
Vector pMirTarget
Synonyms ANHU; hFLT1; SERPINA8
ACCN NM_000029
Insert Size 630 bp
Sequence Data
>SC208213 3' UTR clone of NM_000029
The sequence shown below is from the reference sequence of NM_000029. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGCTGAGCACAGCATGAGGCCAGGGCCCCAGAACACAGTGCCTGGCAAGGCCTCTGCCCCTGGCCTTTGA
GGCAAAGGCCAGCAGCAGATAACAACCCCGGACAAATCAGCGATGTGTCACCCCCAGTCTCCCACCTTTT
CTTCTAATGAGTCGACTTTGAGCTGGAAAGCAGCCGTTTCTCCTTGGTCTAAGTGTGCTGCATGGAGTGA
GCAGTAGAAGCCTGCAGCGGCACAAATGCACCTCCCAGTTTGCTGGGTTTATTTTAGAGAATGGGGGTGG
GGAGGCAAGAACCAGTGTTTAGCGCGGGACTACTGTTCCAAAAAGAATTCCAACCGACCAGCTTGTTTGT
GAAACAAAAAAGTGTTCCCTTTTCAAGTTGAGAACAAAAATTGGGTTTTAAAATTAAAGTATACATTTTT
GCATTGCCTTCGGTTTGTATTTAGTGTCTTGAATGTAAGAACATGACCTCCGTGTAGTGTCTGTAATACC
TTAGTTTTTTCCACAGATGCTTGTGATTTTTGAACAATACGTGAAAGATGCAAGCACCTGAATTTCTGTT
TGAATGCGGAACCATAGCTGGTTATTTCTCCCTTGTGTTAGTAATAAACGTCTTGCCACAATAAGCCTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000029.3
Synonyms ANHU; hFLT1; SERPINA8
Summary The protein encoded by this gene, pre-angiotensinogen or angiotensinogen precursor, is expressed in the liver and is cleaved by the enzyme renin in response to lowered blood pressure. The resulting product, angiotensin I, is then cleaved by angiotensin converting enzyme (ACE) to generate the physiologically active enzyme angiotensin II. The protein is involved in maintaining blood pressure, body fluid and electrolyte homeostasis, and in the pathogenesis of essential hypertension and preeclampsia. Mutations in this gene are associated with susceptibility to essential hypertension, and can cause renal tubular dysgenesis, a severe disorder of renal tubular development. Defects in this gene have also been associated with non-familial structural atrial fibrillation, and inflammatory bowel disease. [provided by RefSeq, Nov 2019]
Locus ID 183
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...