KRT6A (NM_005554) Human 3' UTR Clone

CAT#: SC207326

3' UTR clone of keratin 6A (KRT6A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KRT6A (NM_005554) Human 3' UTR Clone
Vector pMirTarget
Synonyms CK-6C; CK-6E; CK6A; CK6C; CK6D; K6A; K6C; K6D; KRT6C; KRT6D; PC3
ACCN NM_005554
Insert Size 574 bp
Sequence Data
>SC207326 3’UTR clone of NM_005554
The sequence shown below is from the reference sequence of NM_005554. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTCCAGCAGGAAGAGCTATAAGCACTAAAGTGCGTCTGCTAGCTCTCGGTCCCACAGTCCTCAGGCC
CCTCTCTGGCTGCAGAGCCCTCTCCTCAGGTTGCCTTTCCTCTCCTGGCCTCCAGTCTCCCCTGCTGTC
CCAGGTAGAGCTGGGTATGGATGCTTAGTGCCCTCACTTCTTCTCTCTCTCTCTATACCATCTGAGCAC
CCATTGCTCACCATCAGATCAACCTCTGATTTTACATCATGATGTAATCACCACTGGAGCTTCACTGTT
ACTAAATTATTAATTTCTTGCCTCCAGTGTTCTATCTCTGAGGCTGAGCATTATAAGAAAATGACCTCT
GCTCCTTTTCATTGCAGAAAATTGCCAGGGGCTTATTTCAGAACAACTTCCACTTACTTTCCACTGGCT
CTCAAACTCTCTAACTTATAAGTGTTGTGAACCCCCACCCAGGCAGTATCCATGAAAGCACAAGTGACT
AGTCCTATGATGTACAAAGCCTGTATCTCTGTGATGATTTCTGTGCTCTTCGCTGTTTGCAATTGCTAA
ATAAAGCAGATTTATAATACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005554.4
Synonyms CK-6C; CK-6E; CK6A; CK6C; CK6D; K6A; K6C; K6D; KRT6C; KRT6D; PC3
Summary The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. This KRT6 gene in particular encodes the most abundant isoform. Mutations in these genes have been associated with pachyonychia congenita. In addition, peptides from the C-terminal region of the protein have antimicrobial activity against bacterial pathogens. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Oct 2014]
Locus ID 3853
MW 21.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...