Cullin 1 (CUL1) (NM_003592) Human 3' UTR Clone

CAT#: SC207325

3' UTR clone of cullin 1 (CUL1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cullin 1 (CUL1) (NM_003592) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_003592
Insert Size 558 bp
Sequence Data
>SC207325 3’UTR clone of NM_003592
The sequence shown below is from the reference sequence of NM_003592. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAAAGGACACCTACAGTTACTTGGCTTAACCCTTCTGGAAGGGTCTGACTGTGTGACCCGCAGCAAAT
AGTTCATGTTGGAAAGAATGAAAACAACTCAAGTTCATAGCAGCCAGCCTGCCGCCATTGGACCTCCCT
TTTAAAAACTGAGACCAAGACTCCCATCAGCTGGTCTCGGATTTACATCGGAACTGCTCAGGATTGATA
CATTTCAAGTCTGTAAATACGGACACCAACGCCATTTACCCTAATTTAAGAACAGCGGGGACTGACCCT
CCGTGCCGAGGGCTGCATGCTACCGCACTAAGTCAATACATGGGCTCCCCGATTCGCAGCTGTCGTCTT
GGCAGCACTTGTCACGTTGGCAGCACTTTGAGAGCAAGTCTGAGTGGACCCACATGTAACCTGCTATGA
AAACCATTTGTATAGTGTGTTTCATTTTTTAATGTGTGAAAATAAAGAAAATTAAAGGATTTCTGTACA
AGTCGCATTGGGTTTTGTTTTAAGTTTTACTAATTTCTATATGTAAATAAAAGATATAATGATTGTGCA
AATTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003592.3
Summary Core component of multiple cullin-RING-based SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complexes, which mediate the ubiquitination of proteins involved in cell cycle progression, signal transduction and transcription. SCF complexes and ARIH1 collaborate in tandem to mediate ubiquitination of target proteins (PubMed:27565346). In the SCF complex, serves as a rigid scaffold that organizes the SKP1-F-box protein and RBX1 subunits. May contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The E3 ubiquitin-protein ligase activity of the complex is dependent on the neddylation of the cullin subunit and exchange of the substrate recognition component is mediated by TIP120A/CAND1. The functional specificity of the SCF complex depends on the F-box protein as substrate recognition component. SCF(BTRC) and SCF(FBXW11) direct ubiquitination of CTNNB1 and participate in Wnt signaling. SCF(FBXW11) directs ubiquitination of phosphorylated NFKBIA. SCF(BTRC) directs ubiquitination of NFKBIB, NFKBIE, ATF4, SMAD3, SMAD4, CDC25A, FBXO5 and probably NFKB2. SCF(BTRC) and/or SCF(FBXW11) direct ubiquitination of CEP68 (PubMed:25704143, PubMed:25503564). SCF(SKP2) directs ubiquitination of phosphorylated CDKN1B/p27kip and is involved in regulation of G1/S transition. SCF(SKP2) directs ubiquitination of ORC1, CDT1, RBL2, ELF4, CDKN1A, RAG2, FOXO1A, and probably MYC and TAL1. SCF(FBXW7) directs ubiquitination of CCNE1, NOTCH1 released notch intracellular domain (NICD), and probably PSEN1. SCF(FBXW2) directs ubiquitination of GCM1. SCF(FBXO32) directs ubiquitination of MYOD1. SCF(FBXO7) directs ubiquitination of BIRC2 and DLGAP5. SCF(FBXO33) directs ubiquitination of YBX1. SCF(FBXO1) directs ubiquitination of BCL6 and DTL but does not seem to direct ubiquitination of TP53. SCF(BTRC) mediates the ubiquitination of NFKBIA at 'Lys-21' and 'Lys-22'; the degradation frees the associated NFKB1-RELA dimer to translocate into the nucleus and to activate transcription. SCF(CCNF) directs ubiquitination of CCP110. SCF(FBXL3) and SCF(FBXL21) direct ubiquitination of CRY1 and CRY2. SCF(FBXO9) directs ubiquitination of TTI1 and TELO2. SCF(FBXO10) directs ubiquitination of BCL2.[UniProtKB/Swiss-Prot Function]
Locus ID 8454
MW 20.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...