NKG2A (KLRC1) (NM_007328) Human 3' UTR Clone

CAT#: SC207084

3' UTR clone of killer cell lectin-like receptor subfamily C member 1 (KLRC1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NKG2A (KLRC1) (NM_007328) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD159A; NKG2; NKG2A
ACCN NM_007328
Insert Size 553 bp
Sequence Data
>SC207084 3’UTR clone of NM_007328
The sequence shown below is from the reference sequence of NM_007328. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATAATATATCATTGTAAGCATAAGCTTTAGAGGTAAAGCGTTTGCATTTGCAGTGCATCAGATAAATTG
TATATTTCTTAAAATAGAAATATATTATGATTGCATAAATCTTAAAATGAATTATGTTATTTGCTCTAA
TAAGAAAATTCTAAATCAATTATTGAAACAGGATACACACAATTACTAAAGTACAGACATCCTAGCATT
TGTGTCGGGCTCATTTTGCTCAACATGGTATTTGTGGTTTTCAGCCTTTCTAAAAGTTGCATGTTATGT
GAGTCAGCTTATAGGAAGTACCAAGAACAGTCAAACCCATGGAGACAGAAAGTAGAATAGTGGTTGCCA
ATGTCTGAGGGAGGTTGAAATAGGAGATGACCTCTAACTGATAGAACGTTACTTTGTGTCGTGATGAAA
ACTTTCTAAATTTCAGTAGTGGTGATGGTTGTAACTCTGCGAATATACTAAACATCATTGATTTTTAAT
CATTTTAAGTGCATGAAATGTATGCTTTGTACACGACACTTCAATAAAGCTATCCAGAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007328.4
Synonyms CD159A; NKG2; NKG2A
Summary Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor family, also called NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This family of proteins is characterized by the type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1/CD94, and has been implicated in the recognition of the MHC class I HLA-E molecules in NK cells. The genes of NKG2 family members form a killer cell lectin-like receptor gene cluster on chromosome 12. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jan 2015]
Locus ID 3821
MW 21.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...