Placental lactogen (CSH2) (NM_022644) Human 3' UTR Clone

CAT#: SC206972

3' UTR clone of chorionic somatomammotropin hormone 2 (CSH2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Placental lactogen (CSH2) (NM_022644) Human 3' UTR Clone
Vector pMirTarget
Synonyms CS-2; CSB; GHB1; hCS-B; PL
ACCN NM_022644
Insert Size 547 bp
Sequence Data
>SC206972 3’UTR clone of NM_022644
The sequence shown below is from the reference sequence of NM_022644. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCGCCAATCCTGGAACCCCACTGGCTTAGAGGGCTGGGGGAGAGAAACACTGCTGCCCTCTTTGTAGC
AGTCAGGCGCTGACCCAAGAGAACTCACCTTATTCTTCATTTCGCCTGGTGAATCCTCCAGGCCCTTCT
CTACACCCTGAAGGGGAGGGAGGAAAATGGATGAATGAGAGAGGGAGGGAACAGTGCCCAAGCGCTTGG
CCTCTCCTTCTCTTCCTTCACTTTGCAGAGGCTGGAAGACGGCAGCCGCCGGACTGGGCAGATCCTCAA
GCAGACCTACAGCAAGTTTGACACAAACTCACACAACCATGACGCACTGCTCAAGAACTACGGGCTGCT
CTACTGCTTCAGGAAGGACATGGACAAGGTCGAGACATTCCTGCGCATGGTGCAGTGCCGCTCTGTAGA
GGGTAGCTGTGGCTTCTAGGTGCCCGCGTGGCATCCTGTGACCGACCCCTCCCCAGTGCCTCTCCTGGC
CCTGGAAGGTGCCACTCCAGTGCCCATCAGCCTTGTCCTAATAAAATTAAGTTGTATCATTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022644.3
Synonyms CS-2; CSB; GHB1; hCS-B; PL
Summary The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones and plays an important role in growth control. The gene is located at the growth hormone locus on chromosome 17 along with four other related genes in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. Alternative splicing generates additional isoforms of each of the five growth hormones. This particular family member is expressed mainly in the placenta and utilizes multiple transcription initiation sites. Expression of the identical mature proteins for chorionic somatomammotropin hormones 1 and 2 is upregulated during development, while the ratio of 1 to 2 increases by term. Structural and expression differences provide avenues for developmental regulation and tissue specificity. [provided by RefSeq, Jul 2008]
Locus ID 1443
MW 19.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...