RPL13A (NM_012423) Human 3' UTR Clone

CAT#: SC206859

3' UTR clone of ribosomal protein L13a (RPL13A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RPL13A (NM_012423) Human 3' UTR Clone
Vector pMirTarget
Synonyms L13A; TSTA1
ACCN NM_012423
Insert Size 523 bp
Sequence Data
>SC206859 3’UTR clone of NM_012423
The sequence shown below is from the reference sequence of NM_012423. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCCTCAAGACCCACGGACTCCTGGTCTGAGCCCAATAAAGACTGTTAATTCCTCATGCGTTGCCTGCC
CTTCCTCCATTGTTGCCCTGGAATGTACGGGACCCAGGGGCAGCAGCAGTCCAGGTGCCACAGGCAGCC
CTGGGACATAGGAAGCTGGGAGCAAGGAAAGGGTCTTAGTCACTGCCTCCCGAAGTTGCTTGAAAGCAC
TCGGAGAATTGTGCAGGTGTCATTTATCTATGACCAATAGGAAGAGCAACCAGTTACTATGAGTGAAAG
GGAGCCAGAAGACTGATTGGAGGGCCCTATCTTGTGAGTGGGGCATCTGTTGGACTTTCCACCTGGTCA
TATACTCTGCAGCTGTTAGAATGTGCAAGCACTTGGGGACAGCATGAGCTTGCTGTTGTACACAGGGTA
TTTCTAGAAGCAGAAATAGACTGGGAAGATGCACAACCAAGGGGTTACAGGCATCGCCCATGCTCCTCA
CCTGTATTTTGTAATCAGAAATAAATTGCTTTTAAAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_012423.4
Synonyms L13A; TSTA1
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Locus ID 23521
MW 19.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...