B4GALT3 (NM_003779) Human 3' UTR Clone

CAT#: SC206813

3' UTR clone of UDP-Gal:betaGlcNAc beta 14- galactosyltransferase polypeptide 3 (B4GALT3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name B4GALT3 (NM_003779) Human 3' UTR Clone
Vector pMirTarget
Synonyms beta4Gal-T3
ACCN NM_003779
Insert Size 536 bp
Sequence Data
>SC206813 3’UTR clone of NM_003779
The sequence shown below is from the reference sequence of NM_003779. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACCACACAGCCCTCCGAGGTTCACACTGACTCCTCCTTCCTGTCTACCTTAATCATGAAACCGAATTC
ATGGGGTTGTATTCTCCCCACCCTCAGCTCCTCACTGTTCTCAGAGGGATGTGAGGGAACTGAACTCTG
GTGCCGTGCTAGGGGGTAGGGGCCTCTCCCTCACTGCTGGACTGGAGCTGGGCTCCTGTAGACCTGAGG
GGTCCCTCTCTCTAGGGTCTCCTGTAGGGCTTATGACTGTGAATCCTTGATGTCATGATTTTATGTGAC
GATTCCTAGGAGTCCCTGCCCCTAGAGTAGGAGCAGGGCTGGACCCCAAGCCCCTCCCTCTTCCATGGA
GAGAAGAGTGATCTGGCTTCTCCTCGGACCTCTGTGAATATTTATTCTATTTATGGTTCCCGGGAAGTT
GTTTGGTGAAGGAAGCCCCTCCCTGGGCATTTTCTGCCTATGCTGGAATAGCTCCCTCTTCTGGTCCTG
GCTCAGGGGGCTGGGATTTTGATATATTTTCTAATAAAGGACTTTGTCTCGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003779.4
Synonyms beta4Gal-T3
Summary This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Locus ID 8703
MW 19.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...