GSTA2 (NM_000846) Human 3' UTR Clone

CAT#: SC206753

3' UTR clone of glutathione S-transferase alpha 2 (GSTA2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GSTA2 (NM_000846) Human 3' UTR Clone
Vector pMirTarget
Synonyms GST2; GSTA2-2; GTA2; GTH2
ACCN NM_000846
Insert Size 520 bp
Sequence Data
>SC206753 3’UTR clone of NM_000846
The sequence shown below is from the reference sequence of NM_000846. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGAATCAAGGAAGATTTTCAGGTTTTAATAAACCAGCCATAGAGGTCAAGAACATGCAAGACCAGTA
TTCTAAAGTTTTGCAACAATTAAGTGCTTTACCTAAGTGTTGATTGTGCCTGTTGTGAAGCTAATGAAC
TCTTTCAAATTATATGCTAATTAAATAATACAACTCCTATTCACCCACTTAGTTAAAATTGATTTCTTC
TCATTAGGATCTGATGTGAATTCAGTTTTCCAATCTCCTCCTAGCCAACAATTTTCTTGGAATTACAAA
TTCAGTAAAAATGGAAACTATAAATTATGTGGTTTGTTTGACTTTTCCAAGAATTGCCCTGTAACATAC
AATTTGTCATACAATCTATTAAAATGCCAATGTAAAAATGCACCTCTGACATTTTCAGGTATGCACAGG
AGAAGAGTTACCATCCTGGATAATGGCATAAAGACATTTTCTTCTTTTCCTGAACAGTCATTTTATTTC
TGATAAAAGCATTCTTTCTAATGCATTTGCAAAACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000846.5
Synonyms GST2; GSTA2-2; GTA2; GTH2
Summary Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes function in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding these enzymes are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of some drugs. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, located in a cluster mapped to chromosome 6, are the most abundantly expressed glutathione S-transferases in liver. In addition to metabolizing bilirubin and certain anti-cancer drugs in the liver, the alpha class of these enzymes exhibit glutathione peroxidase activity thereby protecting the cells from reactive oxygen species and the products of peroxidation. [provided by RefSeq, Jul 2008]
Locus ID 2939
MW 20.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...