AKR1C2 (NM_001135241) Human 3' UTR Clone

CAT#: SC206732

3' UTR clone of aldo-keto reductase family 1 member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase type III) (AKR1C2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name AKR1C2 (NM_001135241) Human 3' UTR Clone
Vector pMirTarget
Synonyms AKR1C-pseudo; BABP; DD; DD-2; DD/BABP; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8; TDD
ACCN NM_001135241
Insert Size 529 bp
Sequence Data
>SC206732 3’UTR clone of NM_001135241
The sequence shown below is from the reference sequence of NM_001135241. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGAAGAAGAGCCCTAAACATAACTCCTAATTCCTTTCTATGGAACAGAAAGCAATTTTGAATCCATAC
TTCCGTGATTGCATGTCTACAAGAAAAGAGAGTGCAGAATCCTCAAAGCCTCTGCCTCAAAAACTTGAG
GAAATGACAATCATCTCCTTGAAGGCACAAGGTCTTATTTATGATTCCTGATTTCACCTCTTGGGATGT
TCACAGACACAGAGTTTCATGAAGCTGTGGTGTCCAGAAAACCTGCTGCACATAGGGTGCACAATGAGT
TTCCATCTTCTTGCCTCTTTTCAAGGGGCAAGAACTCAGTCCGGGAATGTCTTAAACTACAAACCTTCA
TGGGAAACCTTGTTGCTTCTGCTTCCTCTCTTTTCACACTGGAGGTTTTATTTTTGCTTAGCCATGAAT
TCTTGTGTCATTCATAACTTTTGTCTTAAGGTACTGAAAACTAGTCAGGCTAGTTAATGCAAAAGGGTA
TATTAGATATGATAATGGGAAATCAAAGCCAGGGCTACATTAAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001135241.3
Synonyms AKR1C-pseudo; BABP; DD; DD-2; DD/BABP; DD2; DDH2; HAKRD; HBAB; MCDR2; SRXY8; TDD
Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols using NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme binds bile acid with high affinity, and shows minimal 3-alpha-hydroxysteroid dehydrogenase activity. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Locus ID 1646
MW 20.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...