PKC beta 1 (PRKCB) (NM_212535) Human 3' UTR Clone

CAT#: SC206723

3' UTR clone of protein kinase C beta (PRKCB) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PKC beta 1 (PRKCB) (NM_212535) Human 3' UTR Clone
Vector pMirTarget
Synonyms PKC-beta; PKCB; PKCbeta; PKCI(2); PRKCB1; PRKCB2
ACCN NM_212535
Insert Size 528 bp
Sequence Data
>SC206723 3’UTR clone of NM_212535
The sequence shown below is from the reference sequence of NM_212535. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTAACCCAGAGTTTGTCATTAATGTGTAGGTGAATGCAAACTCCATCGTTGAGCCTGGGGTGTAAGAC
TTCAAGCCAAGCGTATGTATCAATTCTAGTCTTCCAGGATTCACGGTGCACATGCTGGCATTCAACATG
TGGAAAGCTTGTCTTAGAGGGCTTTTCTTTGTATGTGTAGCTTGCTAGTTTGTTTTCTACATTTGAAAA
TGTTTAGTTTAGAATAAGCGCATTATCCAATTATAGAGGTACAATTTTCCAAACTTCCAGAAACTCATC
AAATGAACAGACAATGTCAAAACTACTGTGTCTGATACCAAAATGCTTCAGTATTTGTAATTTTTCAAG
TCAGAAGCTGATGTTCCTGGTAAAAGTTTTTACAGTTATTCTATAATATCTTCTTTGAATGCTAAGCAT
GAGCGATATTTTTAAAAATTGTGAGTAAGCTTTGCAGTTACTGTGAACTATTGTCTCTTGGAGGAAGTT
TTTTGTTTAAGAATTGATATGATTAAACTGAATTAATATATGCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_212535.3
Synonyms PKC-beta; PKCB; PKCbeta; PKCI(2); PRKCB1; PRKCB2
Summary Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Locus ID 5579
MW 20.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...