GNB3 (NM_002075) Human 3' UTR Clone

CAT#: SC206659

3' UTR clone of guanine nucleotide binding protein (G protein) beta polypeptide 3 (GNB3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name GNB3 (NM_002075) Human 3' UTR Clone
Vector pMirTarget
Synonyms CSNB1H
ACCN NM_002075
Insert Size 525 bp
Sequence Data
>SC206659 3’UTR clone of NM_002075
The sequence shown below is from the reference sequence of NM_002075. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGGACAGCTTCCTCAAAATCTGGAACTGAGGAGGCTGGAGAAAGGGAAGTGGAAGGCAGTGAACACAC
TCAGCAGCCCCCTGCCCGACCCCATCTCATTCAGGTGTTCTCTTCTATATTCCGGGTGCCATTCCCACT
AAGCTTTCTCCTTTGAGGGCAGTGGGGAGCATGGGACTGTGCCTTTGGGAGGCAGCATCAGGGACACAG
GGGCAAAGAACTGCCCCATCTCCTCCCATGGCCTTCCCTCCCCACAGTCCTCACAGCCTCTCCCTTAAT
GAGCAAGGACAACCTGCCCCTCCCCAGCCCTTTGCAGGCCCAGCAGACTTGAGTCTGAGGCCCCAGGCC
CTAGGATTCCTCCCCCAGAGCCACTACCTTTGTCCAGGCCTGGGTGGTATAGGGCGTTTGGCCCTGTGA
CTATGGCTCTGGCACCACTAGGGTCCTGGCCCTCTTCTTATTCATGCTTTCTCCTTTTTCTACCTTTTT
TTCTCTCCTAAGACACCTGCAATAAAGTGTAGCACCCTGGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002075.4
Synonyms CSNB1H
Summary Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
Locus ID 2784
MW 18.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...