KIR2.3 (KCNJ4) (NM_004981) Human 3' UTR Clone

CAT#: SC206464

3' UTR clone of potassium inwardly-rectifying channel subfamily J member 4 (KCNJ4) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KIR2.3 (KCNJ4) (NM_004981) Human 3' UTR Clone
Vector pMirTarget
Synonyms HIR; HIRK2; HRK1; IRK-3; IRK3; Kir2.3
ACCN NM_004981
Insert Size 498 bp
Sequence Data
>SC206464 3’UTR clone of NM_004981
The sequence shown below is from the reference sequence of NM_004981. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCTCCTACCGCAGGGAGTCTGCCATCTGACCTCCAGGCCCGGCCCTCACCACTGCCCACAAGAGCCTC
TGCCGGGGGTGGGATGCCAGGACACCCCCTCCCACACTCAGGACAGAGCCAACCCTGGCTCCGTGGACC
TTCTGGAGGAAGGTGGGGGTTTCAAAGACTGGGGGACCCCTTCCTCCTGACTCCAGCACCCAGGCCTGG
GAAGAGCTCGGCCCCGATCAGCCTGAGTTCCGCCAGCGCCTACTTCTGGTGGCTCTAGGTCCCCGGATC
CACCACCCTTCCCCCACTGACTCTTCAAGGACGTGCCCTCTTTGCTCTCAGAACCTTGGGGAAGGTGGC
TGGACTGCTGGGCGGGGGACATCTCGGGGTTTCAGGGTGGGCAGGGGGTTAGTTTGGGGAGGGGGGGGT
GCGTTTCTTTTGCATGACTGTGGCCTGTTGCTCATGACTTTCTTTTGTAAATATCTATAAATGGAGACA
GATGGAGACACCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004981.2
Synonyms HIR; HIRK2; HRK1; IRK-3; IRK3; Kir2.3
Summary Several different potassium channels are known to be involved with electrical signaling in the nervous system. One class is activated by depolarization whereas a second class is not. The latter are referred to as inwardly rectifying K+ channels, and they have a greater tendency to allow potassium to flow into the cell rather than out of it. This asymmetry in potassium ion conductance plays a key role in the excitability of muscle cells and neurons. The protein encoded by this gene is an integral membrane protein and member of the inward rectifier potassium channel family. The encoded protein has a small unitary conductance compared to other members of this protein family. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3761
MW 18.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...