ENPP3 (NM_005021) Human 3' UTR Clone

CAT#: SC206355

3' UTR clone of ectonucleotide pyrophosphatase/phosphodiesterase 3 (ENPP3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ENPP3 (NM_005021) Human 3' UTR Clone
Vector pMirTarget
Synonyms B10; CD203c; NPP3; PD-IBETA; PDNP3
ACCN NM_005021
Insert Size 484 bp
Sequence Data
>SC206355 3’UTR clone of NM_005021
The sequence shown below is from the reference sequence of NM_005021. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATTTACCAACATTTGAAACCACTATTTAACTTAATAATGTCTACTTAATATATAATTTACTGTATAAA
GTAATTTTGGCAAAATATAAGTGATTTTTTTCTGGAGAATTGTAAAATAAAGTTTTCTATTTTTCCTTA
AGTCCCCTAAAAGCCATAATTTTTATTATTCCTTTTTCTCTTTTTTCAATTCTATGAATATGTATTATT
TTAAAGTTATATTTTTCACACAGAGATGATGCTATATTACACCTTCCCTTTTTTGTTGGTTTCTTAAAC
TCTAATCTCATGACAGATTATACCTTCCTTATTACTTGTTTTATCTTACTCAGAATCTTTGAATATATT
TTTCTGCCCAGAATTATCTAAACAAAAGGGAGAACAAAAGAAGTATGTCTCACTTGGGAACTGAATCAA
CTCTAAATCAGTTTTGTCACAAAACTTTTTGTATTTGACTGGCAATGCTGATTAAAATTAAAAATGCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005021.5
Synonyms B10; CD203c; NPP3; PD-IBETA; PDNP3
Summary The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
Locus ID 5169
MW 19.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...