EIF4G1 (NM_182917) Human 3' UTR Clone

CAT#: SC206287

3' UTR clone of eukaryotic translation initiation factor 4 gamma 1 (EIF4G1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name EIF4G1 (NM_182917) Human 3' UTR Clone
Vector pMirTarget
Synonyms EIF-4G1; EIF4F; EIF4G; EIF4GI; P220; PARK18
ACCN NM_182917
Insert Size 497 bp
Sequence Data
>SC206287 3’UTR clone of NM_182917
The sequence shown below is from the reference sequence of NM_182917. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGCAGAGGAGGAGTCTGACCACAACTGAGGGCTGGTGGGGCCGGGGACCTGGAGCCCCATGGACACA
CAGATGGCCCGGCTAGCCGCCTGGACTGCAGGGGGGCGGCAGCAGCGGCGGTGGCAGTGGGTGCCTGTA
GTGTGATGTGTCTGAACTAATAAAGTGGCTGAAGAGGCAGGATGGCTTGGGGCTGCCTGGGCCCCCCTC
CAGGATGCCGCCAGGTGTCCCTCTCCTCCCCCTGGGGCACAGAGATATATTATATATAAAGTCTTGAAA
TTTGGTGTGTCTTGGGGTGGGGAGGGGCACCAACGCCTGCCCCTGGGGTCCTTTTTTTTATTTTCTGAA
AATCACTCTCGGGACTGCCGTCCTCGCTGCTGGGGGCATATGCCCCAGCCCCTGTACCACCCCTGCTGT
TGCCTGGGCAGGGGGAAGGGGGGGCACGGTGCCTGTAATTATTAAACATGAATTCAATTAAGCTCAAAA
AAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_182917.4
Synonyms EIF-4G1; EIF4F; EIF4G; EIF4GI; P220; PARK18
Summary The protein encoded by this gene is a component of the multi-subunit protein complex EIF4F. This complex facilitates the recruitment of mRNA to the ribosome, which is a rate-limiting step during the initiation phase of protein synthesis. The recognition of the mRNA cap and the ATP-dependent unwinding of 5'-terminal secondary structure is catalyzed by factors in this complex. The subunit encoded by this gene is a large scaffolding protein that contains binding sites for other members of the EIF4F complex. A domain at its N-terminus can also interact with the poly(A)-binding protein, which may mediate the circularization of mRNA during translation. Alternative splicing results in multiple transcript variants, some of which are derived from alternative promoter usage. [provided by RefSeq, Aug 2010]
Locus ID 1981
MW 18.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...