PML Protein (PML) (NM_033239) Human 3' UTR Clone

CAT#: SC206185

3' UTR clone of promyelocytic leukemia (PML) transcript variant 9 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PML Protein (PML) (NM_033239) Human 3' UTR Clone
Vector pMirTarget
Synonyms MYL; PP8675; RNF71; TRIM19
ACCN NM_033239
Insert Size 473 bp
Sequence Data
>SC206185 3’UTR clone of NM_033239
The sequence shown below is from the reference sequence of NM_033239. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCCCAGGCGCCCGTCAAGCAGGCCTCTGAGAGTGCTACCCTTCTCTTGTAACCTTGCAGCCAACACCC
CTGCCCGGCCCCTGAGCTGCCTCCTCCAGCCCATGCTCTTACAGGCCCTGCACAGAGTAGCACTCATTA
ATTCTTGGTTAAGGAATGAATCAACGAATGAATGGCTATGCATGGACCTCTGGGCAGGGAGACCTGGGT
CTTCTCTGGCTGAGAGGGGAAGGCTAAGGCATGGCTGAGATTCAAGCCACCATTCCAGGCCTCTTTGCC
CAAGAAAGAAACTTCTGTCACCCTTGCACTCTCCTGTATTCTGAGTCCCTGGCCAATAGCACAGCCTTC
CATGCCCCGACCCCCACCCCAAGCCTCTCCACTAGGCCTCTGCCAGGATCTAAGCCCATGAGCACAGGG
ACTGGCTATCCCAAGACCTGGCAGATGTGGCTGCTCAATAAACACTTGTTGAACCATCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033239.3
Synonyms MYL; PP8675; RNF71; TRIM19
Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 5371
MW 16.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...