PACSIN3 (NM_016223) Human 3' UTR Clone

Specifications

Product Data
Product Name	PACSIN3 (NM_016223) Human 3' UTR Clone
Vector	pMirTarget
Synonyms	SDPIII
ACCN	NM_016223
Insert Size	401 bp
Sequence Data	Insert Sequence (showhide) >SC206155 3’UTR clone of NM_016223 The sequence shown below is from the reference sequence of NM_016223. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites	SgfI-MluI
OTI Disclaimer	Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq	NM_016223.5
Synonyms	SDPIII
Summary	This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Locus ID	29763

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.