TAP2 (NM_018833) Human 3' UTR Clone

CAT#: SC206148

3' UTR clone of transporter 2 ATP-binding cassette sub-family B (MDR/TAP) (TAP2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TAP2 (NM_018833) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABC18; ABCB3; APT2; D6S217E; PSF-2; PSF2; RING11
ACCN NM_018833
Insert Size 488 bp
Sequence Data
>SC206148 3’UTR clone of NM_018833
The sequence shown below is from the reference sequence of NM_018833. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAACCCTTTGGAAGTTCATGATATTTTGAATTTCAATGGATATTTCCTGGGAATAATGAGTTCAAATG
AACGAATATGTGGAACAAAGCATCACCAACATTTATTTTTTCAGGATGAGGTGATGGACAAAACCATCA
CAGGGAAATTGAGGCAAATAGTACATGTAAAACAATACTTCGGGTGAGTCCACCTATCCCAAAGTCGTA
TCAAAGAAGTGGCTGCAGATTGGAGCCCAAAGCCTTTGGTTCCTCAGTTTCCAAATGGATTCTCACTAG
GTGGGATCATGAGTTTGCTTTGGACACCCCAAATTCTAACTATTTCTTTTGTTTCTTACATCCTTTCCC
TCTTCCCCAGCCCCTTCCCCTCATGTTACACCTCTTGCTGGTTTGAGACGTCAATCACCACTGAGAAAG
AATTAAACCAGTATTTTGAGCTGGCAAAATTCTTAGCCTAGTACAATTCCTTCAATTAAACTGTAGCTC
AACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018833.3
Synonyms ABC18; ABCB3; APT2; D6S217E; PSF-2; PSF2; RING11
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene is located 7 kb telomeric to gene family member ABCB2. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with ABCB2 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Alternative splicing of this gene produces products which differ in peptide selectivity and level of restoration of surface expression of MHC class I molecules. [provided by RefSeq, Feb 2014]
Locus ID 6891
MW 18.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...