BAF53A (ACTL6A) (NM_178042) Human 3' UTR Clone

CAT#: SC205996

3' UTR clone of actin-like 6A (ACTL6A) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BAF53A (ACTL6A) (NM_178042) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACTL6; Arp4; ARPN-BETA; BAF53A; INO80K
ACCN NM_178042
Insert Size 445 bp
Sequence Data
>SC205996 3' UTR clone of NM_178042
The sequence shown below is from the reference sequence of NM_178042. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGAAGGAGGGAAGCAGTGTGTAGAAAGAAAATGCCCTTGAGAAAGAGTTCCCAAGCTTCTACCTTCCTT
TTGTCACCTTACGTTTCATAGCTTTAGTATACTCAGGAAAAGAATGACCATCTTTTGTAGAATGTTTATA
CATTTTTGCATATTTCAATTTCCACTTAAATTTTTTAAAGCTTTAACTGGCTCTATAAATTAAGTTTGTG
CTTTCCTTGAAATGCACTTATTCTTATTACAAGCATTTTATAATTTTGTATAAATGTCTATTTTCTCTAA
ATATTTTGCTTTCAGTAAAATGCTTTCCAACTCTGTTTAGTGTATTAATTACCAGTGGATTGGTAGAACT
GCTTTTTATTGACTAGTAAAAGTTACTGCCTATGCTTTTTACCTTAGGCTTACAGAATTAAATAAAAATT
AGCCATTCCAGAAATAAAAAAAAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_178042.2
Synonyms ACTL6; Arp4; ARPN-BETA; BAF53A; INO80K
Summary This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 86
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...