5 Lipoxygenase (ALOX5) (NM_000698) Human 3' UTR Clone

CAT#: SC205988

3' UTR clone of arachidonate 5-lipoxygenase (ALOX5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name 5 Lipoxygenase (ALOX5) (NM_000698) Human 3' UTR Clone
Vector pMirTarget
Synonyms 5-LO; 5-LOX; 5LPG; LOG5
ACCN NM_000698
Insert Size 460 bp
Sequence Data
>SC205988 3’UTR clone of NM_000698
The sequence shown below is from the reference sequence of NM_000698. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCGGATTCCGAACAGTGTGGCCATCTGAGCACACTGCCAGTCTCACTGTGGGAAGGCCAGCTGCCCC
AGCCAGATGGACTCCAGCCTGCCTGGCAGGCTGTCTGGCCAGGCCTCTTGGCAGTCACATCTCTTCCTC
CGAGGCCAGTACCTTTCCATTTATTCTTTGATCTTCAGGGAACTGCATAGATTGATCAAAGTGTAAACA
CCATAGGGACCCATTCTACACAGAGCAGGACTGCACAGCGTCCTGTCCACACCCAGCTCAGCATTTCCA
CACCAAGCAGCAACAGCAAATCACGACCACTGATAGATGTCTATTCTTGTTGGAGACATGGGATGATTA
TTTTCTGTTCTATTTGTGCTTAGTCCAATTCCTTGCACATAGTAGGTACCCAATTCAATTACTATTGAA
TGAATTAAGAATTGGTTGCCATAAAAATAAATCAGTTCATTTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000698.5
Synonyms 5-LO; 5-LOX; 5LPG; LOG5
Summary This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Locus ID 240
MW 16.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...