TRPM5 (NM_014555) Human 3' UTR Clone

CAT#: SC205905

3' UTR clone of transient receptor potential cation channel subfamily M member 5 (TRPM5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name TRPM5 (NM_014555) Human 3' UTR Clone
Vector pMirTarget
Synonyms LTRPC5; MTR1
ACCN NM_014555
Insert Size 452 bp
Sequence Data
>SC205905 3’UTR clone of NM_014555
The sequence shown below is from the reference sequence of NM_014555. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGGCTGGCCAGCCTCCCTCGGACACCTGAGCTGCTTGGCCTGCCACGTGTGGGGCCACCTCTCCTCAG
CTGGCCACCCTGCACGTTGTGCACTGACCTTTGCCGACCTCCAGCGGAACCCCCCAGGGGGCACCAGCC
CCCCAGCAGACAATGGCCCTCCTGGTGCCTCACCACAGACCCTCACCCAAAGGAACCGCTCCTTGTCCC
TCCTGGCCTCCCCGGAGGCACAGCAGTGTCATGGGGCTGTCTCCCCTGACAGGCACAACTCCCCGGGCA
GAAAACGTGCCCCACCGCATCCCTACCTGGAAACTGACCAGCCTGCACTGTGGAAAAGCTGGCCCTGTG
GCGTGACGGGGGAGCACCCCCATCCAGACTGCGAAGCTGCTCTGGGGTCTGCACCCACCCCTGCCCTGA
CTTGTGTTGCCTGACAAGAGACTCATCTTTTTTTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014555.4
Synonyms LTRPC5; MTR1
Summary This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
Locus ID 29850
MW 15.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...