HLAC (HLA-C) (NM_002117) Human 3' UTR Clone

CAT#: SC205868

3' UTR clone of major histocompatibility complex class I C (HLA-C) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HLAC (HLA-C) (NM_002117) Human 3' UTR Clone
Vector pMirTarget
Synonyms D6S204; HLA-JY3; HLAC; HLC-C; MHC; PSORS1
ACCN NM_002117
Insert Size 450 bp
Sequence Data
>SC205868 3’UTR clone of NM_002117
The sequence shown below is from the reference sequence of NM_002117. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGAGTCTCTCATCACTTGTAAAGCCTGAGACAGCTGCCTGTGTGGGACTGAGATGCAGGATTTCTTC
ACACCTCTCCTTTGTGACTTCAAGAGCCTCTGGCATCTCTTTCTGCAAAGGCACCTGAATGTGTCTGCG
TTCCTGTTAGCATAATGTGAGGAGGTGGAGAGACAGCCCACCCCCGTGTCCACCGTGACCCCTGTCCCC
ACACTGACCTGTGTTCCCTCCCCGATCATCTTTCCTGTTCCAGAGAGGTGGGGCTGGATGTCTCCATCT
CTGTCTCAAATTCATGGTGCACTGAGCTGCAACTTCTTACTTCCCTAATGAAGTTAAGAACCTGAATAT
AAATTTGTGTTCTCAAATATTTGCTATGAAGCGTTGATGGATTAATTAAATAAGTCAATTCCTAGAAGT
TGAGAGAGCAAATAAAGACCTGAGAACCTTCCAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002117.6
Synonyms D6S204; HLA-JY3; HLAC; HLC-C; MHC; PSORS1
Summary HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. About 6000 HLA-C alleles have been described. The HLA system plays an important role in the occurrence and outcome of infectious diseases, including those caused by the malaria parasite, the human immunodeficiency virus (HIV), and the severe acute respiratory syndrome coronavirus (SARS-CoV). The structural spike and the nucleocapsid proteins of the novel coronavirus SARS-CoV-2, which causes coronavirus disease 2019 (COVID-19), are reported to contain multiple Class I epitopes with predicted HLA restrictions. Individual HLA genetic variation may help explain different immune responses to a virus across a population.[provided by RefSeq, Aug 2020]
Locus ID 3107
MW 17
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...