HSD11B1 (NM_181755) Human 3' UTR Clone

CAT#: SC205790

3' UTR clone of hydroxysteroid (11-beta) dehydrogenase 1 (HSD11B1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HSD11B1 (NM_181755) Human 3' UTR Clone
Vector pMirTarget
Synonyms 11-beta-HSD1; 11-DH; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1
ACCN NM_181755
Insert Size 429 bp
Sequence Data
>SC205790 3' UTR clone of NM_181755
The sequence shown below is from the reference sequence of NM_181755. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACAGATTCATAAACAAGTAGGAACTCCCTGAGGGCTGGGCATGCTGAGGGATTTTGGGACTGTTCTGTC
TCATGTTTATCTGAGCTCTTATCTATGAAGACATCTTCCCAGAGTGTCCCCAGAGACATGCAAGTCATGG
GTCACACCTGACAAATGGAAGGAGTTCCTCTAACATTTGCAAAATGGAAATGTAATAATAATGAATGTCA
TGCACCGCTGCAGCCAGCAGTTGTAAAATTGTTAGTAAACATAGGTATAATTACCAGATAGTTATATTAA
ATTTATATCTTATATATAATAATATGTGATGATTAATACAATATTAATTATAATAAAGGTCACATAAACT
TTATAAATTCATAACTGGTAGCTATAACTTGAGCTTATTCAGGATGGTTTCTTTAAAACCATAAACTGTA
CAAATGAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_181755.1
Synonyms 11-beta-HSD1; 11-DH; CORTRD2; HDL; HSD11; HSD11B; HSD11L; SDR26C1
Summary The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
Locus ID 3290
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...