COPS6 (NM_006833) Human 3' UTR Clone

CAT#: SC205751

3' UTR clone of COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) (COPS6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name COPS6 (NM_006833) Human 3' UTR Clone
Vector pMirTarget
Synonyms CSN6; MOV34-34KD
ACCN NM_006833
Insert Size 416 bp
Sequence Data
>SC205751 3' UTR clone of NM_006833
The sequence shown below is from the reference sequence of NM_006833. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGGCATCGGCAGGAGAATGCGCGGGCTCTTTTTCTGATGAGGGTACTTGAAGGGCTGATGGACAGGGGT
CAGGCAACTATCCCAAAGGGGAGGGCACTACACTTCCTTGAGAGAAACCGCTGTCATTAATAAAAGGGGA
GCAGCCCCTGAGCACCCCTGCTGGTGGCTCTGTCCTCTGTTAGGCACCACACTGGTTGGTCAACTTGGAT
GTTCATCGAGGCTCATTCTGGCCTTGCTCAGAAGCCCTTCTGATGCTCTTCAGTGAGGGAGGCACTACCA
TTTGAAGTGACCCCATGTCAGTCACATGGACTGGTCTTTAGCAAAGTCCAAGGCTGCCTGCTTCCACCTA
AGTGGTCTCTGTTCTACACTTTAATGTCACCCTCTACATCATCTTACCTAGCCCACCCAACCTTAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006833.4
Synonyms CSN6; MOV34-34KD
Summary The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
Locus ID 10980
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...