Apc11 (ANAPC11) (NM_001002248) Human 3' UTR Clone

CAT#: SC205692

3' UTR clone of anaphase promoting complex subunit 11 (ANAPC11) transcript variant 6 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Apc11 (ANAPC11) (NM_001002248) Human 3' UTR Clone
Vector pMirTarget
Synonyms APC11; Apc11p; HSPC214
ACCN NM_001002248
Insert Size 220 bp
Sequence Data
>SC205692 3’UTR clone of NM_001002248
The sequence shown below is from the reference sequence of NM_001002248. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCCGCCAGGAATGGAAGTTCAAGGAGTGAGGCCCGACCTGGCTCTCGCTGGAGGGGCATCCTGAGACT
CCTTCCTCATGCTGGCGCCGATGGCTGCTGGGGACAGCGCCCCTGAGCTGCAACAAGGTGGAAACAAGG
GCTGGAGCTGCGTTTGTTTTGCCATCACTATGTTGACACTTTTATCCAATAAGTGAAAACTCATTAAAC
TACTCAAATCTTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001002248.3
Synonyms APC11; Apc11p; HSPC214
Summary Together with the cullin protein ANAPC2, constitutes the catalytic component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. May recruit the E2 ubiquitin-conjugating enzymes to the complex.[UniProtKB/Swiss-Prot Function]
Locus ID 51529
MW 8.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...