PKC zeta (PRKCZ) (NM_001033582) Human 3' UTR Clone

CAT#: SC205647

3' UTR clone of protein kinase C zeta (PRKCZ) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PKC zeta (PRKCZ) (NM_001033582) Human 3' UTR Clone
Vector pMirTarget
Synonyms PKC-ZETA; PKC2
ACCN NM_001033582
Insert Size 416 bp
Sequence Data
>SC205647 3’UTR clone of NM_001033582
The sequence shown below is from the reference sequence of NM_001033582. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTATTGCTGTCCACCGAGGAGTCGGTGTGAGGCCGCGTGCGTCTCTGTCGTGGACACGCGTGATTGACC
CTTTAACTGTATCCTTAACCACCGCATATGCATGCCAGGCTGGGCACGGCTCCGAGGGCGGCCAGGGAC
AGACGCTTGCGCCGAGACCGCAGAGGGAAGCGTCAGCGGGCGCTGCTGGGAGCAGAACAGTCCCTCACA
CCTGGGCCCGGGCAGGCCAGCTTCGTGCTGGAGGAACTTGCTGCTGTGCCTGCGTCGCGGCGGATCCGC
GGGGACCCTGCCGAGGGGGCTGTCATGCGGTTTCCAAGGTGCACATTTTCCACGGAAACAGAACTCGAT
GCACTGACCTGCTCCGCCAGGAAAGTGAGCGTGTAGCGTCCTGAGGAATAAAATGTTCCGATGATGTGG
AA
AGCGGACCGACTTACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCC
CAACCTGCCATCACGAGATTTCGATTCCACCGCCGC
Restriction Sites SgfI-RsrII     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001033582.3
Synonyms PKC-ZETA; PKC2
Summary Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Locus ID 5590
MW 15.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...