BBS7 (NM_018190) Human 3' UTR Clone

CAT#: SC205553

3' UTR clone of Bardet-Biedl syndrome 7 (BBS7) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BBS7 (NM_018190) Human 3' UTR Clone
Vector pMirTarget
Synonyms BBS2L1
ACCN NM_018190
Insert Size 444 bp
Sequence Data
>SC205553 3’UTR clone of NM_018190
The sequence shown below is from the reference sequence of NM_018190. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTGCACATCTTGAAAGACTCTATGGTTAGTGGACCATTCTAGAATACCTTGCCATATTTCTTTTCAAC
TGGCTATTTCCCAAGGATCATGTAAGAGAAGCTGGGCAGAAAGATAAAAAGATTACATCAGTCATGATT
CATGAACCAGTCATGAATCAGTTGACAACAAATTTATTGCACAGAATATTTCTGTATTTTGTCAAGCTA
CTTTTAATATTTAATTCTTTTACTTGATAAAATGCAAGTATATTAAGAAATAAGTATACTGTGATGAAT
TAATCTATATATATGAACAAACCTGGTATAAAATGAATGTAATCTATGAACCTTTAGAGCTTAGACTGT
ATTTCACACAAATAATTGTCATGTTTTGTTGCTATTGTGAATTATAAAAATGCAGCATTTAAAATTTTT
AAGGCAAAATTTAATAAAGGATATACAGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_018190.4
Synonyms BBS2L1
Summary This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
Locus ID 55212
MW 17.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...