PCBP1 (NM_006196) Human 3' UTR Clone

CAT#: SC205517

3' UTR clone of poly(rC) binding protein 1 (PCBP1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 4 publications.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PCBP1 (NM_006196) Human 3' UTR Clone
Vector pMirTarget
Synonyms HEL-S-85; hnRNP-E1; hnRNP-X; HNRPE1; HNRPX
ACCN NM_006196
Insert Size 419 bp
Sequence Data
>SC205517 3’UTR clone of NM_006196
The sequence shown below is from the reference sequence of NM_006196. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTCTGAGAAGGGCATGGGGTGCAGCTAGAACAGTGTAGGTTCCCTCAATAACCCCTTTCTGCTGTTC
TCCCATGATCCAACTGTGTAATTTCTGGTCAGTGATTCCAGGTTTTAAATAATTTGTAAGTGTTCAGTT
TCTACACAACTTTATCATCCGCTAAGAATTTAAAAATCACATTCTCTGTTCAGCTGTTAATGCTGGGAT
CCATATTTAGTTTTATAAGCTTTTCCCTGTTTTTAGTTTTGTTTTGGGTTTTTTGGCTCATGAATTTTA
TTTCTGTTTGTCGATAAGAAATGTAAGAGTGGAATGTTAATAAATTTCAGTTTAGTTCTGTAATGTCAA
GAATTTAAGAATTAAAAAACGGATTGGTTAAAAAATGCTTCATATTTGAAAAAGCTGGGAATTGCTGTC
TTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006196.4
Synonyms HEL-S-85; hnRNP-E1; hnRNP-X; HNRPE1; HNRPX
Summary This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. [provided by RefSeq, Jul 2008]
Locus ID 5093
MW 15.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (4)

Documents

Customer Reviews 
Loading...