KCNH2 (NM_000238) Human 3' UTR Clone

CAT#: SC205467

3' UTR clone of potassium voltage-gated channel subfamily H (eag-related) member 2 (KCNH2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name KCNH2 (NM_000238) Human 3' UTR Clone
Vector pMirTarget
Synonyms ERG-1; ERG1; H-ERG; HERG; HERG1; Kv11.1; LQT2; SQT1
ACCN NM_000238
Insert Size 412 bp
Sequence Data
>SC205467 3' UTR clone of NM_000238
The sequence shown below is from the reference sequence of NM_000238. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTGCACAGACACGGCTCGGACCCGGGCAGTTAGTGGGGCTGCCCAGTGTGGACACGTGGCTCACCCAGG
GATCAAGGCGCTGCTGGGCCGCTCCCCTTGGAGGCCCTGCTCAGGAGGCCCTGACCGTGGAAGGGGAGAG
GAACTCGAAAGCACAGCTCCTCCCCCAGCCCTTGGGACCATCTTCTCCTGCAGTCCCCTGGGCCCCAGTG
AGAGGGGCAGGGGCAGGGCCGGCAGTAGGTGGGGCCTGTGGTCCCCCCACTGCCCTGAGGGCATTAGCTG
GTCTAACTGCCCGGAGGCACCCGGCCCTGGGCCTTAGGCACCTCAAGGACTTTTCTGCTATTTACTGCTC
TTATTGTTAAGGATAATAATTAAGGATCATATGAATAATTAATGAAGATGCTGATGACTATG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000238.2
Synonyms ERG-1; ERG1; H-ERG; HERG; HERG1; Kv11.1; LQT2; SQT1
Summary This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Locus ID 3757
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...