FKBP12 (FKBP1A) (NM_054014) Human 3' UTR Clone

CAT#: SC205447

3' UTR clone of FK506 binding protein 1A 12kDa (FKBP1A) transcript variant 12A for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FKBP12 (FKBP1A) (NM_054014) Human 3' UTR Clone
Vector pMirTarget
Synonyms FKBP-1A; FKBP-12; FKBP1; FKBP12; PKC12; PKCI2; PPIASE
ACCN NM_054014
Insert Size 417 bp
Sequence Data
>SC205447 3' UTR clone of NM_054014
The sequence shown below is from the reference sequence of NM_054014. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGACAGGAATGGCCTCCTCCCTTAGCTCC
CTGTTCTTGGGTAAGGAAATGGAATACTGAAGGGCCCTTCACTGCCTTTGCTCCTCCCATGTTATGCCCA
GCGTTTGATGGGTAGCAGAGAGAACAAAAAACACCACAAGGCTATTTTTCCCCCTGCATTCTTTCTGTAT
TGAGTATCCTTTCAGTGTTATTAGTGTATGCTTTGAATGTAAAAATTGGTCACCCTAAGGAAAGGAATTG
GCATGTGTATGTTCCCAGTTCAACTCATGGAGATGGCAGCTGTTTAAATGTTTTTCTATGTAGTTTATAA
ATTAAAACTGAATTGAGGACTATGGAAATGTAGGCCAAATTTGTAGTGCCAACATTTTAGTTCTTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_054014.2
Synonyms FKBP-1A; FKBP-12; FKBP1; FKBP12; PKC12; PKCI2; PPIASE
Summary The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq, Sep 2008]
Locus ID 2280
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...